EMAIL THIS PAGE TO A FRIEND

FAM106A

family with sequence similarity 106, member A

118 Gene Product Result for
Species: Human FAM106A(80039)
UniProtKB ID: Q4KMX7, Q9HAD1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024974 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024974 Rosetta Predictions human pricing
XR_040965 Rosetta Predictions human pricing
XR_040966 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107783 predicted 339
2 SASI_Hs01_00107784 predicted 297
3 SASI_Hs01_00107785 predicted 275
4 SASI_Hs01_00107786 predicted 249
5 SASI_Hs01_00107787 predicted 328
6 SASI_Hs01_00107788 predicted 322
7 SASI_Hs01_00107789 predicted 255
8 SASI_Hs01_00107790 predicted 322
9 SASI_Hs01_00107791 predicted 316
10 SASI_Hs01_00107792 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523462 predicted 193
2 SASI_Hs02_00523463 predicted 196
3 SASI_Hs02_00523464 predicted 201
4 SASI_Hs02_00523465 predicted 199
5 SASI_Hs02_00523466 predicted 204
6 SASI_Hs02_00523467 predicted 26
7 SASI_Hs02_00523468 predicted 28
8 SASI_Hs02_00523469 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523470 predicted 656
2 SASI_Hs02_00523471 predicted 278
3 SASI_Hs02_00523472 predicted 662
4 SASI_Hs02_00523473 predicted 699
5 SASI_Hs02_00523474 predicted 274
6 SASI_Hs02_00523475 predicted 779
7 SASI_Hs02_00523476 predicted 749
8 SASI_Hs02_00523477 predicted 718
9 SASI_Hs02_00523478 predicted 143
10 SASI_Hs02_00523479 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024974
FAM106A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 106, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-279s1c1
Sequence:CCGGGCACTTCATCAGAGGCAATTACTCGAGTAATTGCCTCTGATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024974.1-858s1c1
Sequence:CCGGCCTTTGGAAATAAAGTGGCATCTCGAGATGCCACTTTATTTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024974.1-1557s1c1
Sequence:CCGGGCTCCAATTCAATGGTGTTTACTCGAGTAAACACCATTGAATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024974.1-1247s1c1
Sequence:CCGGGTTCCCAACTAGGTTCTTATACTCGAGTATAAGAACCTAGTTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-333s1c1
Sequence:CCGGCCTCTTTACATGTGTGCATATCTCGAGATATGCACACATGTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-176s1c1
Sequence:CCGGCGTGTAATCCTGATCTCACTTCTCGAGAAGTGAGATCAGGATTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024974
FAM106A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 106, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-279s1c1
Sequence:CCGGGCACTTCATCAGAGGCAATTACTCGAGTAATTGCCTCTGATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024974.1-858s1c1
Sequence:CCGGCCTTTGGAAATAAAGTGGCATCTCGAGATGCCACTTTATTTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024974.1-1557s1c1
Sequence:CCGGGCTCCAATTCAATGGTGTTTACTCGAGTAAACACCATTGAATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024974.1-1247s1c1
Sequence:CCGGGTTCCCAACTAGGTTCTTATACTCGAGTATAAGAACCTAGTTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-333s1c1
Sequence:CCGGCCTCTTTACATGTGTGCATATCTCGAGATATGCACACATGTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-176s1c1
Sequence:CCGGCGTGTAATCCTGATCTCACTTCTCGAGAAGTGAGATCAGGATTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024974
FAM106A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 106, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-279s1c1
Sequence:CCGGGCACTTCATCAGAGGCAATTACTCGAGTAATTGCCTCTGATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024974.1-858s1c1
Sequence:CCGGCCTTTGGAAATAAAGTGGCATCTCGAGATGCCACTTTATTTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024974.1-1557s1c1
Sequence:CCGGGCTCCAATTCAATGGTGTTTACTCGAGTAAACACCATTGAATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024974.1-1247s1c1
Sequence:CCGGGTTCCCAACTAGGTTCTTATACTCGAGTATAAGAACCTAGTTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-333s1c1
Sequence:CCGGCCTCTTTACATGTGTGCATATCTCGAGATATGCACACATGTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024974.1-176s1c1
Sequence:CCGGCGTGTAATCCTGATCTCACTTCTCGAGAAGTGAGATCAGGATTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks