EMAIL THIS PAGE TO A FRIEND

FAM107A

family with sequence similarity 107, member A

122 Gene Product Result for
Synonyms: DRR1 TU3A
UniProtKB ID: O95990, Q96NH4
Gene ID:
Mouse(268709) family with sequence similarity 107, member A
Rat(361018) family with sequence similarity 107, member A
chicken(427591) family with sequence similarity 107, member A
dog(607380) family with sequence similarity 107, member A
cow(538515) family with sequence similarity 107, member A
domestic cat(101101450) family with sequence similarity 107, member A
sheep(101121206) family with sequence similarity 107, member A
naked mole-rat(101716813) family with sequence similarity 107, member A
domestic guinea pig(100734498) family with sequence similarity 107, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108568 Anti-FAM107A IgG fraction of antiserum bovine, mouse, horse, rat, canine, rat, zebrafish, guinea pig, rabbit
western blot pricing
SAB1407112 Anti-FAM107A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV42348 Anti-FAM107A antibody produced in rabbit IgG fraction of antiserum canine, human, rat, mouse, bovine, guinea pig, rabbit, horse
western blot pricing
HPA055888 Anti-FAM107A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076778 Rosetta Predictions human pricing
NM_007177 Rosetta Predictions human pricing
NM_001025129 Rosetta Predictions rat pricing
XM_001060583 Rosetta Predictions rat pricing
XM_001060645 Rosetta Predictions rat pricing
NM_183187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312014 predicted 1198
2 SASI_Hs02_00312015 predicted 993
3 SASI_Hs02_00312016 predicted 1341
4 SASI_Hs02_00312017 predicted 1185
5 SASI_Hs02_00312018 predicted 853
6 SASI_Hs02_00312019 predicted 993
7 SASI_Hs02_00312020 predicted 934
8 SASI_Hs02_00312021 predicted 497
9 SASI_Hs02_00312022 predicted 494
10 SASI_Hs02_00312023 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217253 predicted 1299
2 SASI_Hs01_00217254 predicted 1092
3 SASI_Hs01_00217258 predicted 1435
4 SASI_Hs01_00217259 predicted 1285
5 SASI_Hs01_00217256 predicted 945
6 SASI_Hs01_00217257 predicted 1085
7 SASI_Hs01_00217260 predicted 1031
8 SASI_Hs01_00217261 predicted 592
9 SASI_Hs02_00343129 predicted 595
10 SASI_Hs02_00343130 predicted 852
11 SASI_Hs01_00217255 predicted 1356
12 SASI_Hs01_00217262 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067149 predicted 833
2 SASI_Rn01_00067150 predicted 270
3 SASI_Rn01_00067151 predicted 782
4 SASI_Rn01_00067152 predicted 896
5 SASI_Rn01_00067153 predicted 814
6 SASI_Rn01_00067154 predicted 227
7 SASI_Rn01_00067155 predicted 780
8 SASI_Rn01_00067156 predicted 699
9 SASI_Rn01_00067157 predicted 885
10 SASI_Rn01_00067158 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297102 predicted 203
2 SASI_Rn02_00297103 predicted 292
3 SASI_Rn02_00297104 predicted 791
4 SASI_Rn02_00297105 predicted 476
5 SASI_Rn02_00297106 predicted 315
6 SASI_Rn02_00297107 predicted 750
7 SASI_Rn02_00297108 predicted 324
8 SASI_Rn02_00297109 predicted 761
9 SASI_Rn02_00297110 predicted 669
10 SASI_Rn02_00297111 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297220 predicted 277
2 SASI_Rn02_00297221 predicted 1026
3 SASI_Rn02_00297222 predicted 462
4 SASI_Rn02_00297223 predicted 974
5 SASI_Rn02_00297224 predicted 306
6 SASI_Rn02_00297225 predicted 1008
7 SASI_Rn02_00297226 predicted 416
8 SASI_Rn02_00297227 predicted 312
9 SASI_Rn02_00297228 predicted 973
10 SASI_Rn02_00297229 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179085 predicted 331
2 SASI_Mm01_00179086 predicted 359
3 SASI_Mm01_00179087 predicted 1197
4 SASI_Mm01_00179088 predicted 513
5 SASI_Mm01_00179089 predicted 356
6 SASI_Mm01_00179090 predicted 361
7 SASI_Mm01_00179091 predicted 1184
8 SASI_Mm01_00179092 predicted 1107
9 SASI_Mm01_00179093 predicted 1166
10 SASI_Mm01_00179094 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183187
FAM107A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 107, member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183187.2-2365s1c1
Sequence:CCGGCCCTTTAACATAGTTTCTCATCTCGAGATGAGAAACTATGTTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183187.2-664s1c1
Sequence:CCGGGAGTTCATCAAAGTCCGGGAACTCGAGTTCCCGGACTTTGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-438s21c1
Sequence:CCGGGCACCGTGAGCTGCTTATGAACTCGAGTTCATAAGCAGCTCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-520s21c1
Sequence:CCGGCGCAGGAATCAGCTGATCAAACTCGAGTTTGATCAGCTGATTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183187.3-1516s21c1
Sequence:CCGGACGCACCCAAGAGTGGTATATCTCGAGATATACCACTCTTGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-368s21c1
Sequence:CCGGGGAACTCAGAGCTCATCAAACCTCGAGGTTTGATGAGCTCTGAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-665s21c1
Sequence:CCGGAGTTCATCAAAGTCCGGGAAACTCGAGTTTCCCGGACTTTGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183187
FAM107A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 107, member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183187.2-2365s1c1
Sequence:CCGGCCCTTTAACATAGTTTCTCATCTCGAGATGAGAAACTATGTTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183187.2-664s1c1
Sequence:CCGGGAGTTCATCAAAGTCCGGGAACTCGAGTTCCCGGACTTTGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-438s21c1
Sequence:CCGGGCACCGTGAGCTGCTTATGAACTCGAGTTCATAAGCAGCTCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-520s21c1
Sequence:CCGGCGCAGGAATCAGCTGATCAAACTCGAGTTTGATCAGCTGATTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183187.3-1516s21c1
Sequence:CCGGACGCACCCAAGAGTGGTATATCTCGAGATATACCACTCTTGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-368s21c1
Sequence:CCGGGGAACTCAGAGCTCATCAAACCTCGAGGTTTGATGAGCTCTGAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-665s21c1
Sequence:CCGGAGTTCATCAAAGTCCGGGAAACTCGAGTTTCCCGGACTTTGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183187
FAM107A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 107, member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183187.2-2365s1c1
Sequence:CCGGCCCTTTAACATAGTTTCTCATCTCGAGATGAGAAACTATGTTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183187.2-664s1c1
Sequence:CCGGGAGTTCATCAAAGTCCGGGAACTCGAGTTCCCGGACTTTGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-438s21c1
Sequence:CCGGGCACCGTGAGCTGCTTATGAACTCGAGTTCATAAGCAGCTCACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-520s21c1
Sequence:CCGGCGCAGGAATCAGCTGATCAAACTCGAGTTTGATCAGCTGATTCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183187.3-1516s21c1
Sequence:CCGGACGCACCCAAGAGTGGTATATCTCGAGATATACCACTCTTGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-368s21c1
Sequence:CCGGGGAACTCAGAGCTCATCAAACCTCGAGGTTTGATGAGCTCTGAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183187.3-665s21c1
Sequence:CCGGAGTTCATCAAAGTCCGGGAAACTCGAGTTTCCCGGACTTTGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007177
FAM107A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 107, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-890s1c1
Sequence:CCGGCAAGAAGAAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1194s1c1
Sequence:CCGGCCCACCTGCTTCTGTAGAAATCTCGAGATTTCTACAGAAGCAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-881s1c1
Sequence:CCGGCCAGCTCATCAAGAAGAAGAACTCGAGTTCTTCTTCTTGATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2257s1c1
Sequence:CCGGCCTAGTCTTATGGAAAGCAAACTCGAGTTTGCTTTCCATAAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2101s1c1
Sequence:CCGGCCTAGCAAATTGTGTTGGTTACTCGAGTAACCAACACAATTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-3287s1c1
Sequence:CCGGGCCAATGAAATTGAAGAGGAACTCGAGTTCCTCTTCAATTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1017s1c1
Sequence:CCGGGAGTTTATTAAAGTCAGGGAACTCGAGTTCCCTGACTTTAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1016s1c1
Sequence:CCGGCGAGTTTATTAAAGTCAGGGACTCGAGTCCCTGACTTTAATAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160814    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2184s1c1
Sequence:CCGGCCACACTGTTACGATGCAATTCTCGAGAATTGCATCGTAACAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-705s1c1
Sequence:CCGGCCAGAATACAGAGAGTGGAATCTCGAGATTCCACTCTCTGTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007177
FAM107A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 107, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-890s1c1
Sequence:CCGGCAAGAAGAAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1194s1c1
Sequence:CCGGCCCACCTGCTTCTGTAGAAATCTCGAGATTTCTACAGAAGCAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-881s1c1
Sequence:CCGGCCAGCTCATCAAGAAGAAGAACTCGAGTTCTTCTTCTTGATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2257s1c1
Sequence:CCGGCCTAGTCTTATGGAAAGCAAACTCGAGTTTGCTTTCCATAAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2101s1c1
Sequence:CCGGCCTAGCAAATTGTGTTGGTTACTCGAGTAACCAACACAATTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-3287s1c1
Sequence:CCGGGCCAATGAAATTGAAGAGGAACTCGAGTTCCTCTTCAATTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1017s1c1
Sequence:CCGGGAGTTTATTAAAGTCAGGGAACTCGAGTTCCCTGACTTTAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1016s1c1
Sequence:CCGGCGAGTTTATTAAAGTCAGGGACTCGAGTCCCTGACTTTAATAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160814    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2184s1c1
Sequence:CCGGCCACACTGTTACGATGCAATTCTCGAGAATTGCATCGTAACAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-705s1c1
Sequence:CCGGCCAGAATACAGAGAGTGGAATCTCGAGATTCCACTCTCTGTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007177
FAM107A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 107, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-890s1c1
Sequence:CCGGCAAGAAGAAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163950    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1194s1c1
Sequence:CCGGCCCACCTGCTTCTGTAGAAATCTCGAGATTTCTACAGAAGCAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-881s1c1
Sequence:CCGGCCAGCTCATCAAGAAGAAGAACTCGAGTTCTTCTTCTTGATGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2257s1c1
Sequence:CCGGCCTAGTCTTATGGAAAGCAAACTCGAGTTTGCTTTCCATAAGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2101s1c1
Sequence:CCGGCCTAGCAAATTGTGTTGGTTACTCGAGTAACCAACACAATTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-3287s1c1
Sequence:CCGGGCCAATGAAATTGAAGAGGAACTCGAGTTCCTCTTCAATTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1017s1c1
Sequence:CCGGGAGTTTATTAAAGTCAGGGAACTCGAGTTCCCTGACTTTAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-1016s1c1
Sequence:CCGGCGAGTTTATTAAAGTCAGGGACTCGAGTCCCTGACTTTAATAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160814    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007177.1-2184s1c1
Sequence:CCGGCCACACTGTTACGATGCAATTCTCGAGAATTGCATCGTAACAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007177.1-705s1c1
Sequence:CCGGCCAGAATACAGAGAGTGGAATCTCGAGATTCCACTCTCTGTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks