EMAIL THIS PAGE TO A FRIEND

FAM107B

family with sequence similarity 107, member B

85 Gene Product Result for
Synonyms: C10orf45
UniProtKB ID: Q9H098, A8K1P4, D3DRT2, Q5T9K7, Q5T9K8, Q6ZSI4
Gene ID:
Mouse(66540) family with sequence similarity 107, member B
Rat(498796) family with sequence similarity 107, member B
Zebrafish(386641) family with sequence similarity 107, member B
cow(535023) family with sequence similarity 107, member B
chicken(426376) family with sequence similarity 107, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031453 Rosetta Predictions human pricing
NM_001025034 Rosetta Predictions rat pricing
NM_025626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146366 predicted 1451
2 SASI_Hs01_00146367 predicted 644
3 SASI_Hs01_00146368 predicted 474
4 SASI_Hs01_00146369 predicted 1591
5 SASI_Hs01_00146370 predicted 642
6 SASI_Hs01_00146371 predicted 1272
7 SASI_Hs01_00146372 predicted 578
8 SASI_Hs01_00146373 predicted 275
9 SASI_Hs01_00146374 predicted 1633
10 SASI_Hs01_00146375 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115852 predicted 806
2 SASI_Rn01_00115853 predicted 687
3 SASI_Rn01_00115854 predicted 962
4 SASI_Rn01_00115855 predicted 203
5 SASI_Rn01_00115856 predicted 979
6 SASI_Rn01_00115857 predicted 1030
7 SASI_Rn01_00115858 predicted 832
8 SASI_Rn01_00115859 predicted 802
9 SASI_Rn01_00115860 predicted 239
10 SASI_Rn01_00115861 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328682 predicted 243
2 SASI_Mm01_00098073 predicted 477
3 SASI_Mm01_00098074 predicted 1026
4 SASI_Mm01_00098075 predicted 694
5 SASI_Mm01_00098077 predicted 936
6 SASI_Mm01_00098078 predicted 253
7 SASI_Mm01_00098079 predicted 853
8 SASI_Mm01_00098080 predicted 401
9 SASI_Mm01_00098081 predicted 997
10 SASI_Mm01_00098082 predicted 777
11 SASI_Mm01_00098076 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031453
FAM107B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 107, member B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031453.2-1386s21c1
Sequence:CCGGACCTGTGTTCAGAGACTTAACCTCGAGGTTAAGTCTCTGAACACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031453.2-1085s21c1
Sequence:CCGGCCGAGTTTGTGAAGGTGAAAGCTCGAGCTTTCACCTTCACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-784s1c1
Sequence:CCGGGATGACAATCCTGAACTCATTCTCGAGAATGAGTTCAGGATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-727s1c1
Sequence:CCGGCATAAGGACTCATATCTCATTCTCGAGAATGAGATATGAGTCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031453.2-2495s1c1
Sequence:CCGGCGAAGAATTGTTGAGGATTTACTCGAGTAAATCCTCAACAATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-994s1c1
Sequence:CCGGGACTTGGAAATAGAGCTATTACTCGAGTAATAGCTCTATTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031453
FAM107B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 107, member B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031453.2-1386s21c1
Sequence:CCGGACCTGTGTTCAGAGACTTAACCTCGAGGTTAAGTCTCTGAACACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031453.2-1085s21c1
Sequence:CCGGCCGAGTTTGTGAAGGTGAAAGCTCGAGCTTTCACCTTCACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-784s1c1
Sequence:CCGGGATGACAATCCTGAACTCATTCTCGAGAATGAGTTCAGGATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-727s1c1
Sequence:CCGGCATAAGGACTCATATCTCATTCTCGAGAATGAGATATGAGTCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031453.2-2495s1c1
Sequence:CCGGCGAAGAATTGTTGAGGATTTACTCGAGTAAATCCTCAACAATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-994s1c1
Sequence:CCGGGACTTGGAAATAGAGCTATTACTCGAGTAATAGCTCTATTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031453
FAM107B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 107, member B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031453.2-1386s21c1
Sequence:CCGGACCTGTGTTCAGAGACTTAACCTCGAGGTTAAGTCTCTGAACACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031453.2-1085s21c1
Sequence:CCGGCCGAGTTTGTGAAGGTGAAAGCTCGAGCTTTCACCTTCACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-784s1c1
Sequence:CCGGGATGACAATCCTGAACTCATTCTCGAGAATGAGTTCAGGATTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-727s1c1
Sequence:CCGGCATAAGGACTCATATCTCATTCTCGAGAATGAGATATGAGTCCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167245    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031453.2-2495s1c1
Sequence:CCGGCGAAGAATTGTTGAGGATTTACTCGAGTAAATCCTCAACAATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031453.2-994s1c1
Sequence:CCGGGACTTGGAAATAGAGCTATTACTCGAGTAATAGCTCTATTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025626
VALIDATED
FAM107B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 107, member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025626.4-1182s21c1
Sequence:CCGGCCTATTACTTTGGTTGACATTCTCGAGAATGTCAACCAAAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-470s21c1
Sequence:CCGGGACCTGGAAATAGAACTATTACTCGAGTAATAGTTCTATTTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-560s21c1
Sequence:CCGGCCAGAGTTTGTGAAGGTGAAACTCGAGTTTCACCTTCACAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-515s21c1
Sequence:CCGGCTTGAACTTGAGAAGCAGAAACTCGAGTTTCTGCTTCTCAAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025626.3-415s1c1
Sequence:CCGGGAAGACGAGACCAAGTGATAACTCGAGTTATCACTTGGTCTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-516s1c1
Sequence:CCGGCTTGAACTTGAGAAGCAGAAACTCGAGTTTCTGCTTCTCAAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025626.3-1183s1c1
Sequence:CCGGCCTATTACTTTGGTTGACATTCTCGAGAATGTCAACCAAAGTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-471s1c1
Sequence:CCGGGACCTGGAAATAGAACTATTACTCGAGTAATAGTTCTATTTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025626.3-561s1c1
Sequence:CCGGCCAGAGTTTGTGAAGGTGAAACTCGAGTTTCACCTTCACAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-290s1c1
Sequence:CCGGGAAGCTTATCAACCCTGTCAACTCGAGTTGACAGGGTTGATAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025626
VALIDATED
FAM107B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 107, member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025626.4-1182s21c1
Sequence:CCGGCCTATTACTTTGGTTGACATTCTCGAGAATGTCAACCAAAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-470s21c1
Sequence:CCGGGACCTGGAAATAGAACTATTACTCGAGTAATAGTTCTATTTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-560s21c1
Sequence:CCGGCCAGAGTTTGTGAAGGTGAAACTCGAGTTTCACCTTCACAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-515s21c1
Sequence:CCGGCTTGAACTTGAGAAGCAGAAACTCGAGTTTCTGCTTCTCAAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025626.3-415s1c1
Sequence:CCGGGAAGACGAGACCAAGTGATAACTCGAGTTATCACTTGGTCTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-516s1c1
Sequence:CCGGCTTGAACTTGAGAAGCAGAAACTCGAGTTTCTGCTTCTCAAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025626.3-1183s1c1
Sequence:CCGGCCTATTACTTTGGTTGACATTCTCGAGAATGTCAACCAAAGTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-471s1c1
Sequence:CCGGGACCTGGAAATAGAACTATTACTCGAGTAATAGTTCTATTTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025626.3-561s1c1
Sequence:CCGGCCAGAGTTTGTGAAGGTGAAACTCGAGTTTCACCTTCACAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-290s1c1
Sequence:CCGGGAAGCTTATCAACCCTGTCAACTCGAGTTGACAGGGTTGATAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025626
VALIDATED
FAM107B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 107, member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025626.4-1182s21c1
Sequence:CCGGCCTATTACTTTGGTTGACATTCTCGAGAATGTCAACCAAAGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-470s21c1
Sequence:CCGGGACCTGGAAATAGAACTATTACTCGAGTAATAGTTCTATTTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-560s21c1
Sequence:CCGGCCAGAGTTTGTGAAGGTGAAACTCGAGTTTCACCTTCACAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025626.4-515s21c1
Sequence:CCGGCTTGAACTTGAGAAGCAGAAACTCGAGTTTCTGCTTCTCAAGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025626.3-415s1c1
Sequence:CCGGGAAGACGAGACCAAGTGATAACTCGAGTTATCACTTGGTCTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-516s1c1
Sequence:CCGGCTTGAACTTGAGAAGCAGAAACTCGAGTTTCTGCTTCTCAAGTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025626.3-1183s1c1
Sequence:CCGGCCTATTACTTTGGTTGACATTCTCGAGAATGTCAACCAAAGTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-471s1c1
Sequence:CCGGGACCTGGAAATAGAACTATTACTCGAGTAATAGTTCTATTTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025626.3-561s1c1
Sequence:CCGGCCAGAGTTTGTGAAGGTGAAACTCGAGTTTCACCTTCACAAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025626.3-290s1c1
Sequence:CCGGGAAGCTTATCAACCCTGTCAACTCGAGTTGACAGGGTTGATAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks