EMAIL THIS PAGE TO A FRIEND

FAM109A

family with sequence similarity 109, member A

50 Gene Product Result for
Synonyms: IPIP27A SES1
UniProtKB ID: Q8N4B1, J3KP50, Q6PJL9, Q96MH8
Gene ID:
Human(144717) Summary: This gene encodes a protein that localizes to the endosome and interacts with the enzyme, inositol polyphosphate 5-phosphatase OCRL-1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(231717) family with sequence similarity 109, member A
Rat(288664) family with sequence similarity 109, member A
chicken(101667188) family with sequence similarity 109, member A
chicken(101748488) family with sequence similarity 109, member A
dog(486268) family with sequence similarity 109, member A
cow(785809) family with sequence similarity 109, member A
domestic guinea pig(100719934) family with sequence similarity 109, member A
naked mole-rat(101710048) family with sequence similarity 109, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144671 Rosetta Predictions human pricing
XM_222183 Rosetta Predictions rat pricing
XR_009304 Rosetta Predictions rat pricing
NM_175474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196941 predicted 1161
2 SASI_Hs01_00196942 predicted 1536
3 SASI_Hs01_00196943 predicted 1212
4 SASI_Hs01_00196945 predicted 495
5 SASI_Hs01_00196946 predicted 1302
6 SASI_Hs01_00196944 predicted 515
7 SASI_Hs01_00196947 predicted 452
8 SASI_Hs01_00196948 predicted 652
9 SASI_Hs02_00364567 predicted 1365
10 SASI_Hs01_00196949 predicted 667
11 SASI_Hs01_00196950 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140607 predicted 395
2 SASI_Rn01_00140608 predicted 495
3 SASI_Rn01_00140609 predicted 483
4 SASI_Rn01_00140610 predicted 374
5 SASI_Rn01_00140611 predicted 400
6 SASI_Rn01_00140612 predicted 453
7 SASI_Rn01_00140613 predicted 401
8 SASI_Rn01_00140614 predicted 486
9 SASI_Rn01_00140615 predicted 504
10 SASI_Rn01_00140616 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132726 predicted 238
2 SASI_Rn01_00132727 predicted 319
3 SASI_Rn01_00132728 predicted 320
4 SASI_Rn01_00132729 predicted 208
5 SASI_Rn01_00132730 predicted 238
6 SASI_Rn01_00132731 predicted 281
7 SASI_Rn01_00132732 predicted 230
8 SASI_Rn01_00132733 predicted 313
9 SASI_Rn01_00132734 predicted 331
10 SASI_Rn02_00419352 predicted 322
11 SASI_Rn01_00132735 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088303 predicted 1203
2 SASI_Mm01_00088304 predicted 1037
3 SASI_Mm01_00088305 predicted 1030
4 SASI_Mm01_00088306 predicted 1359
5 SASI_Mm01_00088307 predicted 1049
6 SASI_Mm01_00088308 predicted 1426
7 SASI_Mm01_00088309 predicted 1416
8 SASI_Mm01_00088310 predicted 1433
9 SASI_Mm01_00088311 predicted 573
10 SASI_Mm01_00088312 predicted 1361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144671
FAM109A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 109, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-418s1c1
Sequence:CCGGCGGGAACATGCTCTTCTACTTCTCGAGAAGTAGAAGAGCATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165349    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2863s1c1
Sequence:CCGGGCGTAGGTTTACAGACTCTCACTCGAGTGAGAGTCTGTAAACCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164216    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2478s1c1
Sequence:CCGGCTGGCAACAAAGCTTGATGTTCTCGAGAACATCAAGCTTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2864s1c1
Sequence:CCGGCGTAGGTTTACAGACTCTCAACTCGAGTTGAGAGTCTGTAAACCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-424s1c1
Sequence:CCGGCATGCTCTTCTACTTCGAGGACTCGAGTCCTCGAAGTAGAAGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-349s1c1
Sequence:CCGGCAATGCAGGCTTCCTGTACAACTCGAGTTGTACAGGAAGCCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144671.3-620s21c1
Sequence:CCGGTTCGCCTTCGCTGTGCGCTTTCTCGAGAAAGCGCACAGCGAAGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144671.3-1362s21c1
Sequence:CCGGGAACGTCACGTGCAACACTAACTCGAGTTAGTGTTGCACGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144671.3-515s21c1
Sequence:CCGGCGCGGGAACATGCTCTTCTACCTCGAGGTAGAAGAGCATGTTCCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144671.3-1223s21c1
Sequence:CCGGAGATCCTGAGGGAAATCATGGCTCGAGCCATGATTTCCCTCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144671
FAM109A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 109, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-418s1c1
Sequence:CCGGCGGGAACATGCTCTTCTACTTCTCGAGAAGTAGAAGAGCATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165349    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2863s1c1
Sequence:CCGGGCGTAGGTTTACAGACTCTCACTCGAGTGAGAGTCTGTAAACCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164216    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2478s1c1
Sequence:CCGGCTGGCAACAAAGCTTGATGTTCTCGAGAACATCAAGCTTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2864s1c1
Sequence:CCGGCGTAGGTTTACAGACTCTCAACTCGAGTTGAGAGTCTGTAAACCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-424s1c1
Sequence:CCGGCATGCTCTTCTACTTCGAGGACTCGAGTCCTCGAAGTAGAAGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-349s1c1
Sequence:CCGGCAATGCAGGCTTCCTGTACAACTCGAGTTGTACAGGAAGCCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144671.3-620s21c1
Sequence:CCGGTTCGCCTTCGCTGTGCGCTTTCTCGAGAAAGCGCACAGCGAAGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144671.3-1362s21c1
Sequence:CCGGGAACGTCACGTGCAACACTAACTCGAGTTAGTGTTGCACGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144671.3-515s21c1
Sequence:CCGGCGCGGGAACATGCTCTTCTACCTCGAGGTAGAAGAGCATGTTCCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144671.3-1223s21c1
Sequence:CCGGAGATCCTGAGGGAAATCATGGCTCGAGCCATGATTTCCCTCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144671
FAM109A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 109, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-418s1c1
Sequence:CCGGCGGGAACATGCTCTTCTACTTCTCGAGAAGTAGAAGAGCATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165349    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2863s1c1
Sequence:CCGGGCGTAGGTTTACAGACTCTCACTCGAGTGAGAGTCTGTAAACCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164216    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2478s1c1
Sequence:CCGGCTGGCAACAAAGCTTGATGTTCTCGAGAACATCAAGCTTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164440    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144671.2-2864s1c1
Sequence:CCGGCGTAGGTTTACAGACTCTCAACTCGAGTTGAGAGTCTGTAAACCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-424s1c1
Sequence:CCGGCATGCTCTTCTACTTCGAGGACTCGAGTCCTCGAAGTAGAAGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144671.2-349s1c1
Sequence:CCGGCAATGCAGGCTTCCTGTACAACTCGAGTTGTACAGGAAGCCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144671.3-620s21c1
Sequence:CCGGTTCGCCTTCGCTGTGCGCTTTCTCGAGAAAGCGCACAGCGAAGGCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144671.3-1362s21c1
Sequence:CCGGGAACGTCACGTGCAACACTAACTCGAGTTAGTGTTGCACGTGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144671.3-515s21c1
Sequence:CCGGCGCGGGAACATGCTCTTCTACCTCGAGGTAGAAGAGCATGTTCCCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144671.3-1223s21c1
Sequence:CCGGAGATCCTGAGGGAAATCATGGCTCGAGCCATGATTTCCCTCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175474
FAM109A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 109, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175474.2-1076s1c1
Sequence:CCGGGAATGGCCTGTTTGCAATCCACTCGAGTGGATTGCAAACAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175474.2-1072s1c1
Sequence:CCGGCGTAGAATGGCCTGTTTGCAACTCGAGTTGCAAACAGGCCATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175474.2-1754s1c1
Sequence:CCGGCGCTGCATCCTATGAACAGATCTCGAGATCTGTTCATAGGATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175474.2-1154s1c1
Sequence:CCGGGCACTTACTTCTGAGAAGAATCTCGAGATTCTTCTCAGAAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175474
FAM109A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 109, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175474.2-1076s1c1
Sequence:CCGGGAATGGCCTGTTTGCAATCCACTCGAGTGGATTGCAAACAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175474.2-1072s1c1
Sequence:CCGGCGTAGAATGGCCTGTTTGCAACTCGAGTTGCAAACAGGCCATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175474.2-1754s1c1
Sequence:CCGGCGCTGCATCCTATGAACAGATCTCGAGATCTGTTCATAGGATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175474.2-1154s1c1
Sequence:CCGGGCACTTACTTCTGAGAAGAATCTCGAGATTCTTCTCAGAAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175474
FAM109A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 109, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175474.2-1076s1c1
Sequence:CCGGGAATGGCCTGTTTGCAATCCACTCGAGTGGATTGCAAACAGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175474.2-1072s1c1
Sequence:CCGGCGTAGAATGGCCTGTTTGCAACTCGAGTTGCAAACAGGCCATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175474.2-1754s1c1
Sequence:CCGGCGCTGCATCCTATGAACAGATCTCGAGATCTGTTCATAGGATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175474.2-1154s1c1
Sequence:CCGGGCACTTACTTCTGAGAAGAATCTCGAGATTCTTCTCAGAAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks