EMAIL THIS PAGE TO A FRIEND

FAM109B

family with sequence similarity 109, member B

58 Gene Product Result for
Synonyms: IPIP27B Ses2
UniProtKB ID: Q6ICB4, Q3SXQ3, Q8N6L9
Gene ID:
Mouse(338368) family with sequence similarity 109, member B
Rat(688685) family with sequence similarity 109, member B
naked mole-rat(101697226) family with sequence similarity 109, member B
domestic guinea pig(100720067) family with sequence similarity 109, member B
sheep(101113748) family with sequence similarity 109, member B
chicken(427898) family with sequence similarity 109, member B
cow(506148) family with sequence similarity 109, member B
domestic cat(101083527) family with sequence similarity 109, member B
dog(481225) family with sequence similarity 109, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002034 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053451 MISSION® esiRNA esiRNA human FAM109B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002034 Rosetta Predictions human pricing
NM_001130511 Rosetta Predictions rat pricing
NM_177391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091095 predicted 209
2 SASI_Hs02_00304106 predicted 317
3 SASI_Hs01_00091096 predicted 1419
4 SASI_Hs01_00091097 predicted 1429
5 SASI_Hs01_00091098 predicted 1399
6 SASI_Hs01_00091099 predicted 477
7 SASI_Hs01_00091100 predicted 199
8 SASI_Hs02_00304107 predicted 1405
9 SASI_Hs01_00091101 predicted 1415
10 SASI_Hs01_00091103 predicted 612
11 SASI_Hs01_00091102 predicted 338
12 SASI_Hs01_00091104 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255539 predicted 1032
2 SASI_Rn02_00255540 predicted 1352
3 SASI_Rn02_00255541 predicted 1285
4 SASI_Rn02_00255542 predicted 1498
5 SASI_Rn02_00255543 predicted 979
6 SASI_Rn02_00255544 predicted 817
7 SASI_Rn02_00255545 predicted 1602
8 SASI_Rn02_00255546 predicted 1585
9 SASI_Rn02_00255547 predicted 1018
10 SASI_Rn02_00255548 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050023 predicted 1393
2 SASI_Mm01_00050024 predicted 864
3 SASI_Mm01_00050025 predicted 739
4 SASI_Mm01_00050026 predicted 654
5 SASI_Mm01_00050027 predicted 886
6 SASI_Mm01_00050028 predicted 440
7 SASI_Mm02_00347582 predicted 1499
8 SASI_Mm01_00050029 predicted 724
9 SASI_Mm01_00050030 predicted 330
10 SASI_Mm02_00347583 predicted 521
11 SASI_Mm01_00050031 predicted 1448
12 SASI_Mm01_00050032 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177391
FAM109B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 109, member B
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-572s21c1
Sequence:CCGGGCCTTCGCTATTCGCTTTGATCTCGAGATCAAAGCGAATAGCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-858s21c1
Sequence:CCGGCCATTGGTACTGTGGAAGAAACTCGAGTTTCTTCCACAGTACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-376s21c1
Sequence:CCGGCACTGGCTTTCTGCGTAGTTGCTCGAGCAACTACGCAGAAAGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-888s21c1
Sequence:CCGGGGCCAATAGGTCGGGATTTGACTCGAGTCAAATCCCGACCTATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-676s21c1
Sequence:CCGGCTTTGGCTACATGCGACTTGTCTCGAGACAAGTCGCATGTAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177391.2-1502s1c1
Sequence:CCGGCCATGTATAGTGCTGGACATTCTCGAGAATGTCCAGCACTATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177391.2-1043s1c1
Sequence:CCGGCAGAGAACAAGTCACAGAATACTCGAGTATTCTGTGACTTGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177391.2-445s1c1
Sequence:CCGGCTATTCTCTTTCGAGACTAGACTCGAGTCTAGTCTCGAAAGAGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177391.2-1997s1c1
Sequence:CCGGGCTAAGTTTCTTGTCACAGTACTCGAGTACTGTGACAAGAAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177391.2-745s1c1
Sequence:CCGGGCTGTTGCCAATTGTAGTAAACTCGAGTTTACTACAATTGGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177391.2-2472s1c1
Sequence:CCGGCGTCTATTTGTTTGTTCCCTACTCGAGTAGGGAACAAACAAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177391
FAM109B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 109, member B
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-572s21c1
Sequence:CCGGGCCTTCGCTATTCGCTTTGATCTCGAGATCAAAGCGAATAGCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-858s21c1
Sequence:CCGGCCATTGGTACTGTGGAAGAAACTCGAGTTTCTTCCACAGTACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-376s21c1
Sequence:CCGGCACTGGCTTTCTGCGTAGTTGCTCGAGCAACTACGCAGAAAGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-888s21c1
Sequence:CCGGGGCCAATAGGTCGGGATTTGACTCGAGTCAAATCCCGACCTATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-676s21c1
Sequence:CCGGCTTTGGCTACATGCGACTTGTCTCGAGACAAGTCGCATGTAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177391.2-1502s1c1
Sequence:CCGGCCATGTATAGTGCTGGACATTCTCGAGAATGTCCAGCACTATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177391.2-1043s1c1
Sequence:CCGGCAGAGAACAAGTCACAGAATACTCGAGTATTCTGTGACTTGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177391.2-445s1c1
Sequence:CCGGCTATTCTCTTTCGAGACTAGACTCGAGTCTAGTCTCGAAAGAGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177391.2-1997s1c1
Sequence:CCGGGCTAAGTTTCTTGTCACAGTACTCGAGTACTGTGACAAGAAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177391.2-745s1c1
Sequence:CCGGGCTGTTGCCAATTGTAGTAAACTCGAGTTTACTACAATTGGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177391.2-2472s1c1
Sequence:CCGGCGTCTATTTGTTTGTTCCCTACTCGAGTAGGGAACAAACAAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177391
FAM109B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 109, member B
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-572s21c1
Sequence:CCGGGCCTTCGCTATTCGCTTTGATCTCGAGATCAAAGCGAATAGCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-858s21c1
Sequence:CCGGCCATTGGTACTGTGGAAGAAACTCGAGTTTCTTCCACAGTACCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-376s21c1
Sequence:CCGGCACTGGCTTTCTGCGTAGTTGCTCGAGCAACTACGCAGAAAGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-888s21c1
Sequence:CCGGGGCCAATAGGTCGGGATTTGACTCGAGTCAAATCCCGACCTATTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177391.4-676s21c1
Sequence:CCGGCTTTGGCTACATGCGACTTGTCTCGAGACAAGTCGCATGTAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177391.2-1502s1c1
Sequence:CCGGCCATGTATAGTGCTGGACATTCTCGAGAATGTCCAGCACTATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177391.2-1043s1c1
Sequence:CCGGCAGAGAACAAGTCACAGAATACTCGAGTATTCTGTGACTTGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177391.2-445s1c1
Sequence:CCGGCTATTCTCTTTCGAGACTAGACTCGAGTCTAGTCTCGAAAGAGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177391.2-1997s1c1
Sequence:CCGGGCTAAGTTTCTTGTCACAGTACTCGAGTACTGTGACAAGAAACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177391.2-745s1c1
Sequence:CCGGGCTGTTGCCAATTGTAGTAAACTCGAGTTTACTACAATTGGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177391.2-2472s1c1
Sequence:CCGGCGTCTATTTGTTTGTTCCCTACTCGAGTAGGGAACAAACAAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002034
FAM109B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 109, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1027s1c1
Sequence:CCGGCGCATTTCCAAGGTTGCGTTTCTCGAGAAACGCAACCTTGGAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165812    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1406s1c1
Sequence:CCGGGCTCTGACACTGTCAGAGAAACTCGAGTTTCTCTGACAGTGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1554s1c1
Sequence:CCGGGAAGAGAGATTTATTCTGCTTCTCGAGAAGCAGAATAAATCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1136s1c1
Sequence:CCGGCCATTCCTTCCATCCTCTTTACTCGAGTAAAGAGGATGGAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-334s1c1
Sequence:CCGGCAACCTGCTATTCTCCTTTGACTCGAGTCAAAGGAGAATAGCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-443s1c1
Sequence:CCGGGCCTTTGCCATCTGCTTTGATCTCGAGATCAAAGCAGATGGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-439s1c1
Sequence:CCGGGTTTGCCTTTGCCATCTGCTTCTCGAGAAGCAGATGGCAAAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1168s1c1
Sequence:CCGGCCAGAGAAGGAAGGAGACTTACTCGAGTAAGTCTCCTTCCTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002034
FAM109B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 109, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1027s1c1
Sequence:CCGGCGCATTTCCAAGGTTGCGTTTCTCGAGAAACGCAACCTTGGAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165812    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1406s1c1
Sequence:CCGGGCTCTGACACTGTCAGAGAAACTCGAGTTTCTCTGACAGTGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1554s1c1
Sequence:CCGGGAAGAGAGATTTATTCTGCTTCTCGAGAAGCAGAATAAATCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1136s1c1
Sequence:CCGGCCATTCCTTCCATCCTCTTTACTCGAGTAAAGAGGATGGAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-334s1c1
Sequence:CCGGCAACCTGCTATTCTCCTTTGACTCGAGTCAAAGGAGAATAGCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-443s1c1
Sequence:CCGGGCCTTTGCCATCTGCTTTGATCTCGAGATCAAAGCAGATGGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-439s1c1
Sequence:CCGGGTTTGCCTTTGCCATCTGCTTCTCGAGAAGCAGATGGCAAAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1168s1c1
Sequence:CCGGCCAGAGAAGGAAGGAGACTTACTCGAGTAAGTCTCCTTCCTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002034
FAM109B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 109, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1027s1c1
Sequence:CCGGCGCATTTCCAAGGTTGCGTTTCTCGAGAAACGCAACCTTGGAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165812    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1406s1c1
Sequence:CCGGGCTCTGACACTGTCAGAGAAACTCGAGTTTCTCTGACAGTGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1554s1c1
Sequence:CCGGGAAGAGAGATTTATTCTGCTTCTCGAGAAGCAGAATAAATCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1136s1c1
Sequence:CCGGCCATTCCTTCCATCCTCTTTACTCGAGTAAAGAGGATGGAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-334s1c1
Sequence:CCGGCAACCTGCTATTCTCCTTTGACTCGAGTCAAAGGAGAATAGCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-443s1c1
Sequence:CCGGGCCTTTGCCATCTGCTTTGATCTCGAGATCAAAGCAGATGGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002034.1-439s1c1
Sequence:CCGGGTTTGCCTTTGCCATCTGCTTCTCGAGAAGCAGATGGCAAAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002034.1-1168s1c1
Sequence:CCGGCCAGAGAAGGAAGGAGACTTACTCGAGTAAGTCTCCTTCCTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks