EMAIL THIS PAGE TO A FRIEND

FAM110A

family with sequence similarity 110, member A

136 Gene Product Result for
Synonyms: C20orf55 F10 bA371L19.3
UniProtKB ID: Q9BQ89, D3DVW2, Q5R1M7
Gene ID:
Mouse(73847) family with sequence similarity 110, member A
Rat(311535) family with sequence similarity 110, member A
Zebrafish(100004155) family with sequence similarity 110, member A
cow(540118) family with sequence similarity 110, member A
domestic cat(101084613) family with sequence similarity 110, member A
dog(609631) family with sequence similarity 110, member A
chicken(100858650) family with sequence similarity 110, member A
sheep(101107721) family with sequence similarity 110, member A
domestic guinea pig(100721920) family with sequence similarity 110, member A
naked mole-rat(101697049) family with sequence similarity 110, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042353 Rosetta Predictions human pricing
NM_031424 Rosetta Predictions human pricing
NM_207121 Rosetta Predictions human pricing
NM_001014050 Rosetta Predictions rat pricing
NM_028666 Rosetta Predictions mouse pricing
NM_146127 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309198 predicted 1147
2 SASI_Hs02_00309199 predicted 1311
3 SASI_Hs02_00309200 predicted 1162
4 SASI_Hs02_00309201 predicted 1355
5 SASI_Hs02_00309202 predicted 1321
6 SASI_Hs02_00309203 predicted 1170
7 SASI_Hs02_00309204 predicted 1386
8 SASI_Hs02_00309205 predicted 1377
9 SASI_Hs02_00309206 predicted 1247
10 SASI_Hs02_00309207 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089100 predicted 973
2 SASI_Hs02_00358816 predicted 1134
3 SASI_Hs01_00089101 predicted 986
4 SASI_Hs02_00358817 predicted 1180
5 SASI_Hs01_00089102 predicted 1150
6 SASI_Hs01_00089103 predicted 994
7 SASI_Hs02_00358818 predicted 1208
8 SASI_Hs02_00358819 predicted 1206
9 SASI_Hs01_00089106 predicted 1071
10 SASI_Hs01_00089107 predicted 992
11 SASI_Hs01_00089099 predicted 1103
12 SASI_Hs01_00089104 predicted 1210
13 SASI_Hs01_00089105 predicted 1209
14 SASI_Hs01_00089108 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088555 predicted 961
2 SASI_Hs02_00373771 predicted 1121
3 SASI_Hs01_00088556 predicted 969
4 SASI_Hs02_00373772 predicted 1160
5 SASI_Hs01_00088557 predicted 1133
6 SASI_Hs01_00088558 predicted 974
7 SASI_Hs02_00373773 predicted 1190
8 SASI_Hs02_00373774 predicted 1187
9 SASI_Hs01_00088561 predicted 1056
10 SASI_Hs01_00088562 predicted 972
11 SASI_Hs01_00088554 predicted 1093
12 SASI_Hs01_00088559 predicted 1202
13 SASI_Hs01_00088560 predicted 1199
14 SASI_Hs01_00088563 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201442 predicted 1184
2 SASI_Rn01_00062303 predicted 1211
3 SASI_Rn01_00062304 predicted 1206
4 SASI_Rn01_00062305 predicted 1211
5 SASI_Rn02_00201443 predicted 1141
6 SASI_Rn01_00062308 predicted 1229
7 SASI_Rn02_00201444 predicted 622
8 SASI_Rn01_00062310 predicted 951
9 SASI_Rn01_00062311 predicted 706
10 SASI_Rn02_00201445 predicted 1196
11 SASI_Rn01_00062306 predicted 759
12 SASI_Rn01_00062307 predicted 536
13 SASI_Rn01_00062309 predicted 544
14 SASI_Rn01_00062312 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334208 predicted 1256
2 SASI_Mm01_00196612 predicted 1481
3 SASI_Mm02_00334209 predicted 1265
4 SASI_Mm02_00334210 predicted 1236
5 SASI_Mm02_00334211 predicted 1497
6 SASI_Mm02_00334212 predicted 1270
7 SASI_Mm02_00334213 predicted 1365
8 SASI_Mm02_00334214 predicted 1259
9 SASI_Mm01_00196610 predicted 581
10 SASI_Mm02_00334215 predicted 1317
11 SASI_Mm01_00196605 predicted 435
12 SASI_Mm01_00196606 predicted 427
13 SASI_Mm01_00196607 predicted 442
14 SASI_Mm01_00196608 predicted 527
15 SASI_Mm01_00196609 predicted 438
16 SASI_Mm01_00196611 predicted 451
17 SASI_Mm01_00196613 predicted 889
18 SASI_Mm01_00196614 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124679 predicted 1116
2 SASI_Mm01_00124680 predicted 1343
3 SASI_Mm01_00124681 predicted 1122
4 SASI_Mm02_00341790 predicted 1100
5 SASI_Mm02_00341791 predicted 1359
6 SASI_Mm02_00341792 predicted 1124
7 SASI_Mm02_00341793 predicted 1231
8 SASI_Mm02_00341794 predicted 1123
9 SASI_Mm01_00124677 predicted 445
10 SASI_Mm02_00341795 predicted 1187
11 SASI_Mm01_00124672 predicted 357
12 SASI_Mm01_00124673 predicted 349
13 SASI_Mm01_00124674 predicted 357
14 SASI_Mm01_00124675 predicted 449
15 SASI_Mm01_00124676 predicted 345
16 SASI_Mm01_00124678 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031424
FAM110A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031424.3-1573s1c1
Sequence:CCGGGAGTCTGCATTGCTTTGACTTCTCGAGAAGTCAAAGCAATGCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-716s21c1
Sequence:CCGGCAACGCTCCAAGTCGGACTTGCTCGAGCAAGTCCGACTTGGAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-483s21c1
Sequence:CCGGTCAGCAGCCTCATCGACTTGTCTCGAGACAAGTCGATGAGGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031424.4-1070s21c1
Sequence:CCGGTTCGCCACAGGACGGATCTTACTCGAGTAAGATCCGTCCTGTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-990s21c1
Sequence:CCGGGCGTGATCAAGTGGTTGTATGCTCGAGCATACAACCACTTGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031424
FAM110A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031424.3-1573s1c1
Sequence:CCGGGAGTCTGCATTGCTTTGACTTCTCGAGAAGTCAAAGCAATGCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-716s21c1
Sequence:CCGGCAACGCTCCAAGTCGGACTTGCTCGAGCAAGTCCGACTTGGAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-483s21c1
Sequence:CCGGTCAGCAGCCTCATCGACTTGTCTCGAGACAAGTCGATGAGGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031424.4-1070s21c1
Sequence:CCGGTTCGCCACAGGACGGATCTTACTCGAGTAAGATCCGTCCTGTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-990s21c1
Sequence:CCGGGCGTGATCAAGTGGTTGTATGCTCGAGCATACAACCACTTGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031424
FAM110A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031424.3-1573s1c1
Sequence:CCGGGAGTCTGCATTGCTTTGACTTCTCGAGAAGTCAAAGCAATGCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-716s21c1
Sequence:CCGGCAACGCTCCAAGTCGGACTTGCTCGAGCAAGTCCGACTTGGAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-483s21c1
Sequence:CCGGTCAGCAGCCTCATCGACTTGTCTCGAGACAAGTCGATGAGGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031424.4-1070s21c1
Sequence:CCGGTTCGCCACAGGACGGATCTTACTCGAGTAAGATCCGTCCTGTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031424.4-990s21c1
Sequence:CCGGGCGTGATCAAGTGGTTGTATGCTCGAGCATACAACCACTTGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028666
VALIDATED
FAM110A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028666.2-1009s21c1
Sequence:CCGGTCGGACTTGAGTGAGCGCTTTCTCGAGAAAGCGCTCACTCAAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-577s21c1
Sequence:CCGGCTGGAGGCTGATAAGGCTAAGCTCGAGCTTAGCCTTATCAGCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1271s21c1
Sequence:CCGGGTGTGATCAAGTGGCTATATGCTCGAGCATATAGCCACTTGATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1427s21c1
Sequence:CCGGAGAGACTCTTGGGTGAATTTACTCGAGTAAATTCACCCAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1246s21c1
Sequence:CCGGGTGTCTGTGATCGAGCGAAACCTCGAGGTTTCGCTCGATCACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028666
VALIDATED
FAM110A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028666.2-1009s21c1
Sequence:CCGGTCGGACTTGAGTGAGCGCTTTCTCGAGAAAGCGCTCACTCAAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-577s21c1
Sequence:CCGGCTGGAGGCTGATAAGGCTAAGCTCGAGCTTAGCCTTATCAGCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1271s21c1
Sequence:CCGGGTGTGATCAAGTGGCTATATGCTCGAGCATATAGCCACTTGATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1427s21c1
Sequence:CCGGAGAGACTCTTGGGTGAATTTACTCGAGTAAATTCACCCAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1246s21c1
Sequence:CCGGGTGTCTGTGATCGAGCGAAACCTCGAGGTTTCGCTCGATCACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028666
VALIDATED
FAM110A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028666.2-1009s21c1
Sequence:CCGGTCGGACTTGAGTGAGCGCTTTCTCGAGAAAGCGCTCACTCAAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-577s21c1
Sequence:CCGGCTGGAGGCTGATAAGGCTAAGCTCGAGCTTAGCCTTATCAGCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1271s21c1
Sequence:CCGGGTGTGATCAAGTGGCTATATGCTCGAGCATATAGCCACTTGATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1427s21c1
Sequence:CCGGAGAGACTCTTGGGTGAATTTACTCGAGTAAATTCACCCAAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028666.2-1246s21c1
Sequence:CCGGGTGTCTGTGATCGAGCGAAACCTCGAGGTTTCGCTCGATCACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks