EMAIL THIS PAGE TO A FRIEND

FAM110B

family with sequence similarity 110, member B

158 Gene Product Result for
Synonyms: C8orf72
UniProtKB ID: Q8TC76, Q5BM08, Q9Y4K2
Gene ID:
Mouse(242297) family with sequence similarity 110, member B
Rat(500400) family with sequence similarity 110, member B
naked mole-rat(101704639) family with sequence similarity 110, member B
domestic guinea pig(100723432) family with sequence similarity 110, member B
sheep(101116581) family with sequence similarity 110, member B
Zebrafish(573995) family with sequence similarity 110, member B
chicken(421134) family with sequence similarity 110, member B
cow(767946) family with sequence similarity 110, member B
domestic cat(101098846) family with sequence similarity 110, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147189 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147189 Rosetta Predictions human pricing
NM_001024341 Rosetta Predictions rat pricing
NM_173426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232717 predicted 1755
2 SASI_Hs01_00232718 predicted 1902
3 SASI_Hs01_00232719 predicted 1921
4 SASI_Hs01_00232720 predicted 1892
5 SASI_Hs01_00232721 predicted 2039
6 SASI_Hs02_00365532 predicted 1847
7 SASI_Hs02_00365533 predicted 1983
8 SASI_Hs01_00232724 predicted 2026
9 SASI_Hs01_00232725 predicted 2074
10 SASI_Hs01_00232726 predicted 1875
11 SASI_Hs01_00232722 predicted 1852
12 SASI_Hs01_00232723 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121028 predicted 557
2 SASI_Rn01_00121029 predicted 296
3 SASI_Rn01_00121030 predicted 487
4 SASI_Rn01_00121031 predicted 1254
5 SASI_Rn01_00121032 predicted 1135
6 SASI_Rn01_00121033 predicted 1229
7 SASI_Rn01_00121034 predicted 1343
8 SASI_Rn02_00202569 predicted 1300
9 SASI_Rn01_00121036 predicted 1316
10 SASI_Rn02_00202570 predicted 1235
11 SASI_Rn01_00121035 predicted 1168
12 SASI_Rn01_00121037 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198064 predicted 1675
2 SASI_Mm01_00198065 predicted 1504
3 SASI_Mm01_00198066 predicted 792
4 SASI_Mm01_00198067 predicted 914
5 SASI_Mm01_00198068 predicted 1650
6 SASI_Mm01_00198069 predicted 1620
7 SASI_Mm01_00198070 predicted 1590
8 SASI_Mm01_00198071 predicted 1654
9 SASI_Mm01_00198072 predicted 1417
10 SASI_Mm01_00198073 predicted 1658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173426
FAM110B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1043s21c1
Sequence:CCGGCACAAGCATAGCTCCCGAAACCTCGAGGTTTCGGGAGCTATGCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1516s21c1
Sequence:CCGGGGCTAATTCTGACATCATATCCTCGAGGATATGATGTCAGAATTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1592s21c1
Sequence:CCGGAGTAACAGTGACCTTAGAAATCTCGAGATTTCTAAGGTCACTGTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1405s21c1
Sequence:CCGGAGACTTGAGTGACAGGTATTTCTCGAGAAATACCTGTCACTCAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1693s1c1
Sequence:CCGGGCATCAAACAAGCTAGAGAGTCTCGAGACTCTCTAGCTTGTTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1654s1c1
Sequence:CCGGCCATTGAAAGAAATGCTAGAACTCGAGTTCTAGCATTTCTTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173426.1-1405s1c1
Sequence:CCGGCAGACTTGAGTGACAGGTATTCTCGAGAATACCTGTCACTCAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1668s1c1
Sequence:CCGGGCTAGAATCATCAAGTGGCTACTCGAGTAGCCACTTGATGATTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-986s1c1
Sequence:CCGGGCTTGAGATCCTCAAGAACATCTCGAGATGTTCTTGAGGATCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1679s1c1
Sequence:CCGGCAAGTGGCTATATAGCATCAACTCGAGTTGATGCTATATAGCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173426
FAM110B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1043s21c1
Sequence:CCGGCACAAGCATAGCTCCCGAAACCTCGAGGTTTCGGGAGCTATGCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1516s21c1
Sequence:CCGGGGCTAATTCTGACATCATATCCTCGAGGATATGATGTCAGAATTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1592s21c1
Sequence:CCGGAGTAACAGTGACCTTAGAAATCTCGAGATTTCTAAGGTCACTGTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1405s21c1
Sequence:CCGGAGACTTGAGTGACAGGTATTTCTCGAGAAATACCTGTCACTCAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1693s1c1
Sequence:CCGGGCATCAAACAAGCTAGAGAGTCTCGAGACTCTCTAGCTTGTTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1654s1c1
Sequence:CCGGCCATTGAAAGAAATGCTAGAACTCGAGTTCTAGCATTTCTTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173426.1-1405s1c1
Sequence:CCGGCAGACTTGAGTGACAGGTATTCTCGAGAATACCTGTCACTCAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1668s1c1
Sequence:CCGGGCTAGAATCATCAAGTGGCTACTCGAGTAGCCACTTGATGATTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-986s1c1
Sequence:CCGGGCTTGAGATCCTCAAGAACATCTCGAGATGTTCTTGAGGATCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1679s1c1
Sequence:CCGGCAAGTGGCTATATAGCATCAACTCGAGTTGATGCTATATAGCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173426
FAM110B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1043s21c1
Sequence:CCGGCACAAGCATAGCTCCCGAAACCTCGAGGTTTCGGGAGCTATGCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1516s21c1
Sequence:CCGGGGCTAATTCTGACATCATATCCTCGAGGATATGATGTCAGAATTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1592s21c1
Sequence:CCGGAGTAACAGTGACCTTAGAAATCTCGAGATTTCTAAGGTCACTGTTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173426.2-1405s21c1
Sequence:CCGGAGACTTGAGTGACAGGTATTTCTCGAGAAATACCTGTCACTCAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1693s1c1
Sequence:CCGGGCATCAAACAAGCTAGAGAGTCTCGAGACTCTCTAGCTTGTTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1654s1c1
Sequence:CCGGCCATTGAAAGAAATGCTAGAACTCGAGTTCTAGCATTTCTTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173426.1-1405s1c1
Sequence:CCGGCAGACTTGAGTGACAGGTATTCTCGAGAATACCTGTCACTCAAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1668s1c1
Sequence:CCGGGCTAGAATCATCAAGTGGCTACTCGAGTAGCCACTTGATGATTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-986s1c1
Sequence:CCGGGCTTGAGATCCTCAAGAACATCTCGAGATGTTCTTGAGGATCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173426.1-1679s1c1
Sequence:CCGGCAAGTGGCTATATAGCATCAACTCGAGTTGATGCTATATAGCCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147189
FAM110B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147189.2-2264s21c1
Sequence:CCGGGGTATACAACTTCTTCGATATCTCGAGATATCGAAGAAGTTGTATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147189.2-1989s21c1
Sequence:CCGGTGTAAGACAGTGCGTGGAAAGCTCGAGCTTTCCACGCACTGTCTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1437s1c1
Sequence:CCGGGCTAGAATCATCAAGTGGTTACTCGAGTAACCACTTGATGATTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1281s1c1
Sequence:CCGGGCAAGGGCTAATTCTGACATACTCGAGTATGTCAGAATTAGCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1174s1c1
Sequence:CCGGCAGACTTGAGTGACAGATATTCTCGAGAATATCTGTCACTCAAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147189.1-2262s1c1
Sequence:CCGGCGACAGAATGACCACCCTAAACTCGAGTTTAGGGTGGTCATTCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1424s1c1
Sequence:CCGGCATCGAAAGAAATGCTAGAATCTCGAGATTCTAGCATTTCTTTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147189
FAM110B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147189.2-2264s21c1
Sequence:CCGGGGTATACAACTTCTTCGATATCTCGAGATATCGAAGAAGTTGTATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147189.2-1989s21c1
Sequence:CCGGTGTAAGACAGTGCGTGGAAAGCTCGAGCTTTCCACGCACTGTCTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1437s1c1
Sequence:CCGGGCTAGAATCATCAAGTGGTTACTCGAGTAACCACTTGATGATTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1281s1c1
Sequence:CCGGGCAAGGGCTAATTCTGACATACTCGAGTATGTCAGAATTAGCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1174s1c1
Sequence:CCGGCAGACTTGAGTGACAGATATTCTCGAGAATATCTGTCACTCAAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147189.1-2262s1c1
Sequence:CCGGCGACAGAATGACCACCCTAAACTCGAGTTTAGGGTGGTCATTCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1424s1c1
Sequence:CCGGCATCGAAAGAAATGCTAGAATCTCGAGATTCTAGCATTTCTTTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147189
FAM110B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147189.2-2264s21c1
Sequence:CCGGGGTATACAACTTCTTCGATATCTCGAGATATCGAAGAAGTTGTATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147189.2-1989s21c1
Sequence:CCGGTGTAAGACAGTGCGTGGAAAGCTCGAGCTTTCCACGCACTGTCTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1437s1c1
Sequence:CCGGGCTAGAATCATCAAGTGGTTACTCGAGTAACCACTTGATGATTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1281s1c1
Sequence:CCGGGCAAGGGCTAATTCTGACATACTCGAGTATGTCAGAATTAGCCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1174s1c1
Sequence:CCGGCAGACTTGAGTGACAGATATTCTCGAGAATATCTGTCACTCAAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147189.1-2262s1c1
Sequence:CCGGCGACAGAATGACCACCCTAAACTCGAGTTTAGGGTGGTCATTCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147189.1-1424s1c1
Sequence:CCGGCATCGAAAGAAATGCTAGAATCTCGAGATTCTAGCATTTCTTTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)