EMAIL THIS PAGE TO A FRIEND

FAM110C

family with sequence similarity 110, member C

UniProtKB ID: Q1W6H9
Gene ID:
Mouse(104943) family with sequence similarity 110, member C
Rat(500638) family with sequence similarity 110, member C
chicken(100859913) family with sequence similarity 110, member C
cow(616619) family with sequence similarity 110, member C
domestic guinea pig(100723619) family with sequence similarity 110, member C
naked mole-rat(101702644) family with sequence similarity 110, member C
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001077710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077710 Rosetta Predictions human pricing
XM_925823 Rosetta Predictions human pricing
NM_001025051 Rosetta Predictions rat pricing
XM_001075934 Rosetta Predictions rat pricing
NM_027828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313236 predicted 630
2 SASI_Hs02_00313237 predicted 713
3 SASI_Hs02_00313238 predicted 716
4 SASI_Hs02_00313239 predicted 641
5 SASI_Hs02_00313240 predicted 602
6 SASI_Hs02_00313241 predicted 732
7 SASI_Hs02_00313242 predicted 632
8 SASI_Hs02_00313243 predicted 602
9 SASI_Hs02_00313244 predicted 514
10 SASI_Hs02_00313245 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275352 predicted 1227
2 SASI_Hs01_00275353 predicted 1282
3 SASI_Hs01_00275354 predicted 836
4 SASI_Hs01_00275355 predicted 1146
5 SASI_Hs01_00275356 predicted 801
6 SASI_Hs01_00275357 predicted 1050
7 SASI_Hs01_00275358 predicted 1279
8 SASI_Hs01_00275359 predicted 929
9 SASI_Hs01_00275360 predicted 1159
10 SASI_Hs01_00275361 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048412 predicted 1139
2 SASI_Rn01_00048413 predicted 331
3 SASI_Rn01_00048414 predicted 313
4 SASI_Rn01_00048415 predicted 480
5 SASI_Rn01_00048416 predicted 1081
6 SASI_Rn01_00048417 predicted 1241
7 SASI_Rn01_00048418 predicted 1184
8 SASI_Rn01_00048419 predicted 1043
9 SASI_Rn01_00048421 predicted 823
10 SASI_Rn02_00202983 predicted 1055
11 SASI_Rn01_00048420 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351558 predicted 669
2 SASI_Rn02_00351559 predicted 536
3 SASI_Rn02_00351560 predicted 927
4 SASI_Rn02_00351561 predicted 486
5 SASI_Rn02_00351562 predicted 856
6 SASI_Rn02_00351563 predicted 459
7 SASI_Rn02_00351564 predicted 627
8 SASI_Rn02_00351565 predicted 451
9 SASI_Rn02_00351566 predicted 456
10 SASI_Rn02_00351567 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042232 predicted 1617
2 SASI_Mm02_00332778 predicted 1395
3 SASI_Mm01_00042233 predicted 1442
4 SASI_Mm02_00332779 predicted 365
5 SASI_Mm01_00042234 predicted 356
6 SASI_Mm01_00042235 predicted 1473
7 SASI_Mm01_00042236 predicted 1467
8 SASI_Mm01_00042237 predicted 512
9 SASI_Mm01_00042238 predicted 1561
10 SASI_Mm01_00042239 predicted 1128
11 SASI_Mm01_00042240 predicted 1002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027828
VALIDATED
FAM110C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027828.2-1747s1c1
Sequence:CCGGGCAATGTTATTCTCCTTTCAACTCGAGTTGAAAGGAGAATAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027828.2-648s1c1
Sequence:CCGGCGAATGAAGATAAGACGACGACTCGAGTCGTCGTCTTATCTTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027828.2-1372s21c1
Sequence:CCGGGTGATGAACAGACCCATAAATCTCGAGATTTATGGGTCTGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-2157s21c1
Sequence:CCGGCCCTCCTTCTTACCTTATAAACTCGAGTTTATAAGGTAAGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-1896s21c1
Sequence:CCGGTGTTATACAACTGGTAGTATTCTCGAGAATACTACCAGTTGTATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-1460s21c1
Sequence:CCGGTAGGAATAAAGCACTCTATTGCTCGAGCAATAGAGTGCTTTATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027828.2-2079s21c1
Sequence:CCGGCTTGAGATTTAGCCAATATTTCTCGAGAAATATTGGCTAAATCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027828
VALIDATED
FAM110C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027828.2-1747s1c1
Sequence:CCGGGCAATGTTATTCTCCTTTCAACTCGAGTTGAAAGGAGAATAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027828.2-648s1c1
Sequence:CCGGCGAATGAAGATAAGACGACGACTCGAGTCGTCGTCTTATCTTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027828.2-1372s21c1
Sequence:CCGGGTGATGAACAGACCCATAAATCTCGAGATTTATGGGTCTGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-2157s21c1
Sequence:CCGGCCCTCCTTCTTACCTTATAAACTCGAGTTTATAAGGTAAGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-1896s21c1
Sequence:CCGGTGTTATACAACTGGTAGTATTCTCGAGAATACTACCAGTTGTATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-1460s21c1
Sequence:CCGGTAGGAATAAAGCACTCTATTGCTCGAGCAATAGAGTGCTTTATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027828.2-2079s21c1
Sequence:CCGGCTTGAGATTTAGCCAATATTTCTCGAGAAATATTGGCTAAATCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027828
VALIDATED
FAM110C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027828.2-1747s1c1
Sequence:CCGGGCAATGTTATTCTCCTTTCAACTCGAGTTGAAAGGAGAATAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027828.2-648s1c1
Sequence:CCGGCGAATGAAGATAAGACGACGACTCGAGTCGTCGTCTTATCTTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027828.2-1372s21c1
Sequence:CCGGGTGATGAACAGACCCATAAATCTCGAGATTTATGGGTCTGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-2157s21c1
Sequence:CCGGCCCTCCTTCTTACCTTATAAACTCGAGTTTATAAGGTAAGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-1896s21c1
Sequence:CCGGTGTTATACAACTGGTAGTATTCTCGAGAATACTACCAGTTGTATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027828.2-1460s21c1
Sequence:CCGGTAGGAATAAAGCACTCTATTGCTCGAGCAATAGAGTGCTTTATTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027828.2-2079s21c1
Sequence:CCGGCTTGAGATTTAGCCAATATTTCTCGAGAAATATTGGCTAAATCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077710
FAM110C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-299s21c1
Sequence:CCGGTGATCATCTACCGGCAGAAATCTCGAGATTTCTGCCGGTAGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-288s21c1
Sequence:CCGGACCGGACTCGCTGATCATCTACTCGAGTAGATGATCAGCGAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-720s21c1
Sequence:CCGGGTCGGACTGTGTGACCCTCAACTCGAGTTGAGGGTCACACAGTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-642s21c1
Sequence:CCGGGTCTGACACCTTCTTCCAGTACTCGAGTACTGGAAGAAGGTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077710
FAM110C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-299s21c1
Sequence:CCGGTGATCATCTACCGGCAGAAATCTCGAGATTTCTGCCGGTAGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-288s21c1
Sequence:CCGGACCGGACTCGCTGATCATCTACTCGAGTAGATGATCAGCGAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-720s21c1
Sequence:CCGGGTCGGACTGTGTGACCCTCAACTCGAGTTGAGGGTCACACAGTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-642s21c1
Sequence:CCGGGTCTGACACCTTCTTCCAGTACTCGAGTACTGGAAGAAGGTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077710
FAM110C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-299s21c1
Sequence:CCGGTGATCATCTACCGGCAGAAATCTCGAGATTTCTGCCGGTAGATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-288s21c1
Sequence:CCGGACCGGACTCGCTGATCATCTACTCGAGTAGATGATCAGCGAGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-720s21c1
Sequence:CCGGGTCGGACTGTGTGACCCTCAACTCGAGTTGAGGGTCACACAGTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077710.1-642s21c1
Sequence:CCGGGTCTGACACCTTCTTCCAGTACTCGAGTACTGGAAGAAGGTGTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks