EMAIL THIS PAGE TO A FRIEND

FAM110D

family with sequence similarity 110, member D

32 Gene Product Result for
Synonyms: GRRP1 RP11-96L14.5
UniProtKB ID: Q8TAY7, A8K3V0, Q9H7Z4
Gene ID:
Rat(500563) family with sequence similarity 110, member D
naked mole-rat(101707476) family with sequence similarity 110, member D
domestic guinea pig(100731202) family with sequence similarity 110, member D
sheep(101116811) family with sequence similarity 110, member D
chicken(419603) family with sequence similarity 110, member D
domestic cat(101100495) family with sequence similarity 110, member D
cow(787384) glycine/arginine rich protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024869 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139391 MISSION® esiRNA esiRNA human GRRP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024869 Rosetta Predictions human pricing
NM_001109270 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188061 predicted 250
2 SASI_Hs01_00188062 predicted 420
3 SASI_Hs02_00357456 predicted 452
4 SASI_Hs02_00357457 predicted 460
5 SASI_Hs01_00188065 predicted 261
6 SASI_Hs01_00188067 predicted 276
7 SASI_Hs01_00188068 predicted 270
8 SASI_Hs01_00188069 predicted 275
9 SASI_Hs01_00188070 predicted 615
10 SASI_Hs02_00357458 predicted 455
11 SASI_Hs01_00188063 predicted 452
12 SASI_Hs01_00188064 predicted 430
13 SASI_Hs01_00188066 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246764 predicted 403
2 SASI_Rn02_00246765 predicted 225
3 SASI_Rn02_00246766 predicted 597
4 SASI_Rn02_00246767 predicted 433
5 SASI_Rn02_00246768 predicted 396
6 SASI_Rn02_00246769 predicted 389
7 SASI_Rn02_00246770 predicted 390
8 SASI_Rn02_00246771 predicted 603
9 SASI_Rn02_00246772 predicted 392
10 SASI_Rn02_00246773 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024869
FAM110D MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 110, member D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024869.1-1240s1c1
Sequence:CCGGGCAAACCTGCTGAATAAAGTTCTCGAGAACTTTATTCAGCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024869.1-1235s1c1
Sequence:CCGGGATGAGCAAACCTGCTGAATACTCGAGTATTCAGCAGGTTTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-459s1c1
Sequence:CCGGGCTTCGGTGAACAAAGAGAACCTCGAGGTTCTCTTTGTTCACCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024869.1-659s1c1
Sequence:CCGGGAAGGAGCGCTTCTTCAACTACTCGAGTAGTTGAAGAAGCGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024869.1-455s1c1
Sequence:CCGGCAAGGCTTCGGTGAACAAAGACTCGAGTCTTTGTTCACCGAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-1082s1c1
Sequence:CCGGCCTTCCTTCTGGAACTCAGTTCTCGAGAACTGAGTTCCAGAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-251s1c1
Sequence:CCGGGAAGCCGACAAAGCCAAGTATCTCGAGATACTTGGCTTTGTCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024869.1-1233s1c1
Sequence:CCGGGAGATGAGCAAACCTGCTGAACTCGAGTTCAGCAGGTTTGCTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-465s1c1
Sequence:CCGGGTGAACAAAGAGAACGCCAAGCTCGAGCTTGGCGTTCTCTTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024869
FAM110D MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 110, member D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024869.1-1240s1c1
Sequence:CCGGGCAAACCTGCTGAATAAAGTTCTCGAGAACTTTATTCAGCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024869.1-1235s1c1
Sequence:CCGGGATGAGCAAACCTGCTGAATACTCGAGTATTCAGCAGGTTTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-459s1c1
Sequence:CCGGGCTTCGGTGAACAAAGAGAACCTCGAGGTTCTCTTTGTTCACCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024869.1-659s1c1
Sequence:CCGGGAAGGAGCGCTTCTTCAACTACTCGAGTAGTTGAAGAAGCGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024869.1-455s1c1
Sequence:CCGGCAAGGCTTCGGTGAACAAAGACTCGAGTCTTTGTTCACCGAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-1082s1c1
Sequence:CCGGCCTTCCTTCTGGAACTCAGTTCTCGAGAACTGAGTTCCAGAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-251s1c1
Sequence:CCGGGAAGCCGACAAAGCCAAGTATCTCGAGATACTTGGCTTTGTCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024869.1-1233s1c1
Sequence:CCGGGAGATGAGCAAACCTGCTGAACTCGAGTTCAGCAGGTTTGCTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-465s1c1
Sequence:CCGGGTGAACAAAGAGAACGCCAAGCTCGAGCTTGGCGTTCTCTTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024869
FAM110D MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 110, member D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024869.1-1240s1c1
Sequence:CCGGGCAAACCTGCTGAATAAAGTTCTCGAGAACTTTATTCAGCAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024869.1-1235s1c1
Sequence:CCGGGATGAGCAAACCTGCTGAATACTCGAGTATTCAGCAGGTTTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-459s1c1
Sequence:CCGGGCTTCGGTGAACAAAGAGAACCTCGAGGTTCTCTTTGTTCACCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024869.1-659s1c1
Sequence:CCGGGAAGGAGCGCTTCTTCAACTACTCGAGTAGTTGAAGAAGCGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024869.1-455s1c1
Sequence:CCGGCAAGGCTTCGGTGAACAAAGACTCGAGTCTTTGTTCACCGAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-1082s1c1
Sequence:CCGGCCTTCCTTCTGGAACTCAGTTCTCGAGAACTGAGTTCCAGAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-251s1c1
Sequence:CCGGGAAGCCGACAAAGCCAAGTATCTCGAGATACTTGGCTTTGTCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024869.1-1233s1c1
Sequence:CCGGGAGATGAGCAAACCTGCTGAACTCGAGTTCAGCAGGTTTGCTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024869.1-465s1c1
Sequence:CCGGGTGAACAAAGAGAACGCCAAGCTCGAGCTTGGCGTTCTCTTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks