EMAIL THIS PAGE TO A FRIEND

FAM111A

family with sequence similarity 111, member A

81 Gene Product Result for
Synonyms: GCLEB KCS2
Gene ID:
Mouse(107373) family with sequence similarity 111, member A
Rat(499322) family with sequence similarity 111, member A
dog(609888) family with sequence similarity 111, member A
domestic cat(101098490) family with sequence similarity 111, member A
domestic guinea pig(100722692) family with sequence similarity 111, member A
naked mole-rat(101709738) family with sequence similarity 111, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022074 Rosetta Predictions human pricing
NM_198847 Rosetta Predictions human pricing
NM_001109163 Rosetta Predictions rat pricing
NM_026640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200487 predicted 1410
2 SASI_Hs01_00200488 predicted 615
3 SASI_Hs02_00355441 predicted 1800
4 SASI_Hs01_00200489 predicted 1749
5 SASI_Hs01_00200490 predicted 1879
6 SASI_Hs01_00200491 predicted 1387
7 SASI_Hs01_00200492 predicted 1573
8 SASI_Hs01_00200494 predicted 446
9 SASI_Hs01_00200495 predicted 531
10 SASI_Hs02_00355442 predicted 521
11 SASI_Hs01_00200493 predicted 717
12 SASI_Hs01_00200496 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109225 predicted 1366
2 SASI_Hs01_00109226 predicted 575
3 SASI_Hs02_00372354 predicted 1762
4 SASI_Hs01_00109227 predicted 1713
5 SASI_Hs01_00109228 predicted 1846
6 SASI_Hs01_00109229 predicted 1343
7 SASI_Hs01_00109230 predicted 1527
8 SASI_Hs01_00109232 predicted 405
9 SASI_Hs01_00109233 predicted 490
10 SASI_Hs02_00372355 predicted 481
11 SASI_Hs01_00109231 predicted 683
12 SASI_Hs01_00109234 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245750 predicted 477
2 SASI_Rn02_00245751 predicted 1681
3 SASI_Rn02_00245752 predicted 708
4 SASI_Rn02_00245753 predicted 1025
5 SASI_Rn02_00245754 predicted 1915
6 SASI_Rn02_00245755 predicted 2045
7 SASI_Rn02_00245756 predicted 1757
8 SASI_Rn02_00245757 predicted 1223
9 SASI_Rn02_00245758 predicted 1445
10 SASI_Rn02_00245759 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146391 predicted 1836
2 SASI_Mm02_00330628 predicted 1955
3 SASI_Mm01_00146393 predicted 1644
4 SASI_Mm02_00330629 predicted 1840
5 SASI_Mm01_00146396 predicted 1474
6 SASI_Mm01_00146397 predicted 2009
7 SASI_Mm01_00146398 predicted 1553
8 SASI_Mm01_00146399 predicted 2007
9 SASI_Mm02_00330630 predicted 1529
10 SASI_Mm02_00330631 predicted 1804
11 SASI_Mm01_00146390 predicted 1509
12 SASI_Mm01_00146392 predicted 786
13 SASI_Mm01_00146394 predicted 644
14 SASI_Mm01_00146395 predicted 1538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026640
FAM111A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 111, member A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026640.1-2454s1c1
Sequence:CCGGGCTTCTGGAAACTTGAACCAACTCGAGTTGGTTCAAGTTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1614s1c1
Sequence:CCGGGCTGGGCTGTATCATAGAATACTCGAGTATTCTATGATACAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1615s1c1
Sequence:CCGGCTGGGCTGTATCATAGAATAACTCGAGTTATTCTATGATACAGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1121s1c1
Sequence:CCGGGCTAGAAGAGTACATTGTGAACTCGAGTTCACAATGTACTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026640.1-2588s1c1
Sequence:CCGGCCCTTCTTCCACTTTGGCTTTCTCGAGAAAGCCAAAGTGGAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026640.2-1554s1c1
Sequence:CCGGCTGATAAACACCTTGACTATGCTCGAGCATAGTCAAGGTGTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-772s21c1
Sequence:CCGGGGACCAAGCATCTACCAATTACTCGAGTAATTGGTAGATGCTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026640.2-2485s21c1
Sequence:CCGGCTCATTTGGTTCTACGCTTATCTCGAGATAAGCGTAGAACCAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-1614s21c1
Sequence:CCGGCTGGGCTGTATCATAGAATAACTCGAGTTATTCTATGATACAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-1641s21c1
Sequence:CCGGTGCCACATAGTGGGTTGATTTCTCGAGAAATCAACCCACTATGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-646s21c1
Sequence:CCGGAGGAATTGAAGGGTACTTAAACTCGAGTTTAAGTACCCTTCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026640
FAM111A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 111, member A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026640.1-2454s1c1
Sequence:CCGGGCTTCTGGAAACTTGAACCAACTCGAGTTGGTTCAAGTTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1614s1c1
Sequence:CCGGGCTGGGCTGTATCATAGAATACTCGAGTATTCTATGATACAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1615s1c1
Sequence:CCGGCTGGGCTGTATCATAGAATAACTCGAGTTATTCTATGATACAGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1121s1c1
Sequence:CCGGGCTAGAAGAGTACATTGTGAACTCGAGTTCACAATGTACTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026640.1-2588s1c1
Sequence:CCGGCCCTTCTTCCACTTTGGCTTTCTCGAGAAAGCCAAAGTGGAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026640.2-1554s1c1
Sequence:CCGGCTGATAAACACCTTGACTATGCTCGAGCATAGTCAAGGTGTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-772s21c1
Sequence:CCGGGGACCAAGCATCTACCAATTACTCGAGTAATTGGTAGATGCTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026640.2-2485s21c1
Sequence:CCGGCTCATTTGGTTCTACGCTTATCTCGAGATAAGCGTAGAACCAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-1614s21c1
Sequence:CCGGCTGGGCTGTATCATAGAATAACTCGAGTTATTCTATGATACAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-1641s21c1
Sequence:CCGGTGCCACATAGTGGGTTGATTTCTCGAGAAATCAACCCACTATGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-646s21c1
Sequence:CCGGAGGAATTGAAGGGTACTTAAACTCGAGTTTAAGTACCCTTCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026640
FAM111A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 111, member A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026640.1-2454s1c1
Sequence:CCGGGCTTCTGGAAACTTGAACCAACTCGAGTTGGTTCAAGTTTCCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1614s1c1
Sequence:CCGGGCTGGGCTGTATCATAGAATACTCGAGTATTCTATGATACAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1615s1c1
Sequence:CCGGCTGGGCTGTATCATAGAATAACTCGAGTTATTCTATGATACAGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026640.1-1121s1c1
Sequence:CCGGGCTAGAAGAGTACATTGTGAACTCGAGTTCACAATGTACTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026640.1-2588s1c1
Sequence:CCGGCCCTTCTTCCACTTTGGCTTTCTCGAGAAAGCCAAAGTGGAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026640.2-1554s1c1
Sequence:CCGGCTGATAAACACCTTGACTATGCTCGAGCATAGTCAAGGTGTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-772s21c1
Sequence:CCGGGGACCAAGCATCTACCAATTACTCGAGTAATTGGTAGATGCTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026640.2-2485s21c1
Sequence:CCGGCTCATTTGGTTCTACGCTTATCTCGAGATAAGCGTAGAACCAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-1614s21c1
Sequence:CCGGCTGGGCTGTATCATAGAATAACTCGAGTTATTCTATGATACAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-1641s21c1
Sequence:CCGGTGCCACATAGTGGGTTGATTTCTCGAGAAATCAACCCACTATGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026640.2-646s21c1
Sequence:CCGGAGGAATTGAAGGGTACTTAAACTCGAGTTTAAGTACCCTTCAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022074
VALIDATED
FAM111A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 111, member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-1438s1c1
Sequence:CCGGGTCAATGTGTAAGGGTGACATCTCGAGATGTCACCCTTACACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-753s1c1
Sequence:CCGGGCATCGACTGAATGTGTCAAACTCGAGTTTGACACATTCAGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022074.2-1701s1c1
Sequence:CCGGCGAGCAAAGAAATGTCAGGAACTCGAGTTCCTGACATTTCTTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-618s1c1
Sequence:CCGGGAAGGAATCAAAGAGTACATACTCGAGTATGTACTCTTTGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-789s21c1
Sequence:CCGGATTGGAATTGGGAAGTGTAAACTCGAGTTTACACTTCCCAATTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2230s21c1
Sequence:CCGGCACTATGAGATGGACTATAACCTCGAGGTTATAGTCCATCTCATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1416s21c1
Sequence:CCGGAGTAAGTGGGCAACCATAATTCTCGAGAATTATGGTTGCCCACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1921s21c1
Sequence:CCGGATGAGACTCGTAGTATCATTGCTCGAGCAATGATACTACGAGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1370s21c1
Sequence:CCGGTTGTCGGCATGTAATAGATAGCTCGAGCTATCTATTACATGCCGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2207s21c1
Sequence:CCGGCATGAAGAAATTAGTCCTAACCTCGAGGTTAGGACTAATTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2089s21c1
Sequence:CCGGGGCTTATGGAGTTGTTATTTCCTCGAGGAAATAACAACTCCATAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022074
VALIDATED
FAM111A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 111, member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-1438s1c1
Sequence:CCGGGTCAATGTGTAAGGGTGACATCTCGAGATGTCACCCTTACACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-753s1c1
Sequence:CCGGGCATCGACTGAATGTGTCAAACTCGAGTTTGACACATTCAGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022074.2-1701s1c1
Sequence:CCGGCGAGCAAAGAAATGTCAGGAACTCGAGTTCCTGACATTTCTTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-618s1c1
Sequence:CCGGGAAGGAATCAAAGAGTACATACTCGAGTATGTACTCTTTGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-789s21c1
Sequence:CCGGATTGGAATTGGGAAGTGTAAACTCGAGTTTACACTTCCCAATTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2230s21c1
Sequence:CCGGCACTATGAGATGGACTATAACCTCGAGGTTATAGTCCATCTCATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1416s21c1
Sequence:CCGGAGTAAGTGGGCAACCATAATTCTCGAGAATTATGGTTGCCCACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1921s21c1
Sequence:CCGGATGAGACTCGTAGTATCATTGCTCGAGCAATGATACTACGAGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1370s21c1
Sequence:CCGGTTGTCGGCATGTAATAGATAGCTCGAGCTATCTATTACATGCCGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2207s21c1
Sequence:CCGGCATGAAGAAATTAGTCCTAACCTCGAGGTTAGGACTAATTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2089s21c1
Sequence:CCGGGGCTTATGGAGTTGTTATTTCCTCGAGGAAATAACAACTCCATAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022074
VALIDATED
FAM111A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 111, member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-1438s1c1
Sequence:CCGGGTCAATGTGTAAGGGTGACATCTCGAGATGTCACCCTTACACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-753s1c1
Sequence:CCGGGCATCGACTGAATGTGTCAAACTCGAGTTTGACACATTCAGTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022074.2-1701s1c1
Sequence:CCGGCGAGCAAAGAAATGTCAGGAACTCGAGTTCCTGACATTTCTTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022074.2-618s1c1
Sequence:CCGGGAAGGAATCAAAGAGTACATACTCGAGTATGTACTCTTTGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-789s21c1
Sequence:CCGGATTGGAATTGGGAAGTGTAAACTCGAGTTTACACTTCCCAATTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2230s21c1
Sequence:CCGGCACTATGAGATGGACTATAACCTCGAGGTTATAGTCCATCTCATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1416s21c1
Sequence:CCGGAGTAAGTGGGCAACCATAATTCTCGAGAATTATGGTTGCCCACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1921s21c1
Sequence:CCGGATGAGACTCGTAGTATCATTGCTCGAGCAATGATACTACGAGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022074.3-1370s21c1
Sequence:CCGGTTGTCGGCATGTAATAGATAGCTCGAGCTATCTATTACATGCCGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2207s21c1
Sequence:CCGGCATGAAGAAATTAGTCCTAACCTCGAGGTTAGGACTAATTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022074.3-2089s21c1
Sequence:CCGGGGCTTATGGAGTTGTTATTTCCTCGAGGAAATAACAACTCCATAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks