EMAIL THIS PAGE TO A FRIEND

FAM111B

family with sequence similarity 111, member B

Synonyms: CANP
UniProtKB ID: Q6SJ93, B4E2G2, Q6P661
Gene ID:
sheep(101109642) family with sequence similarity 111, member B
domestic cat(101095194) family with sequence similarity 111, member B
dog(609897) family with sequence similarity 111, member B
cow(509351) family with sequence similarity 111, member B
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198947 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007251 MISSION® esiRNA esiRNA targeting human FAM111B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198947 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225055 predicted 1202
2 SASI_Hs02_00372454 predicted 765
3 SASI_Hs01_00225056 predicted 1795
4 SASI_Hs01_00225057 predicted 425
5 SASI_Hs01_00225058 predicted 1618
6 SASI_Hs01_00225059 predicted 1603
7 SASI_Hs01_00225061 predicted 490
8 SASI_Hs01_00225062 predicted 2000
9 SASI_Hs02_00372455 predicted 313
10 SASI_Hs01_00225063 predicted 2040
11 SASI_Hs01_00225060 predicted 380
12 SASI_Hs01_00225064 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198947
VALIDATED
FAM111B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 111, member B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198947.3-2642s21c1
Sequence:CCGGGCATACAGCAAAGATCTAATACTCGAGTATTAGATCTTTGCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198947.3-1066s21c1
Sequence:CCGGCAACAGAAAGATATCCATAAACTCGAGTTTATGGATATCTTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-1544s1c1
Sequence:CCGGGCGAACAGCTTACATATTATACTCGAGTATAATATGTAAGCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198947.1-3016s1c1
Sequence:CCGGCCATAAAGACATGCACATATACTCGAGTATATGTGCATGTCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-3226s1c1
Sequence:CCGGGCAGGAACAGAAAGCCAAGTACTCGAGTACTTGGCTTTCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-638s1c1
Sequence:CCGGGCCTGCCTAGTGATTCTCATTCTCGAGAATGAGAATCACTAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198947
VALIDATED
FAM111B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 111, member B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198947.3-2642s21c1
Sequence:CCGGGCATACAGCAAAGATCTAATACTCGAGTATTAGATCTTTGCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198947.3-1066s21c1
Sequence:CCGGCAACAGAAAGATATCCATAAACTCGAGTTTATGGATATCTTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-1544s1c1
Sequence:CCGGGCGAACAGCTTACATATTATACTCGAGTATAATATGTAAGCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198947.1-3016s1c1
Sequence:CCGGCCATAAAGACATGCACATATACTCGAGTATATGTGCATGTCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-3226s1c1
Sequence:CCGGGCAGGAACAGAAAGCCAAGTACTCGAGTACTTGGCTTTCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-638s1c1
Sequence:CCGGGCCTGCCTAGTGATTCTCATTCTCGAGAATGAGAATCACTAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198947
VALIDATED
FAM111B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 111, member B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198947.3-2642s21c1
Sequence:CCGGGCATACAGCAAAGATCTAATACTCGAGTATTAGATCTTTGCTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198947.3-1066s21c1
Sequence:CCGGCAACAGAAAGATATCCATAAACTCGAGTTTATGGATATCTTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-1544s1c1
Sequence:CCGGGCGAACAGCTTACATATTATACTCGAGTATAATATGTAAGCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167304    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198947.1-3016s1c1
Sequence:CCGGCCATAAAGACATGCACATATACTCGAGTATATGTGCATGTCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-3226s1c1
Sequence:CCGGGCAGGAACAGAAAGCCAAGTACTCGAGTACTTGGCTTTCTGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198947.1-638s1c1
Sequence:CCGGGCCTGCCTAGTGATTCTCATTCTCGAGAATGAGAATCACTAGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks