EMAIL THIS PAGE TO A FRIEND

FAM114A1

family with sequence similarity 114, member A1

79 Gene Product Result for
Synonyms: Noxp20
UniProtKB ID: Q8IWE2, A8K9W6, Q9BVL6
Gene ID:
Mouse(68303) family with sequence similarity 114, member A1
Rat(498366) family with sequence similarity 114, member A1
Zebrafish(560911) family with sequence similarity 114, member A1
cow(511583) family with sequence similarity 114, member A1
domestic cat(101085038) family with sequence similarity 114, member A1
dog(479114) family with sequence similarity 114, member A1
chicken(426196) family with sequence similarity 114, member A1
sheep(101112224) family with sequence similarity 114, member A1
naked mole-rat(101719230) family with sequence similarity 114, member A1
domestic guinea pig(100713939) family with sequence similarity 114, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138389 Rosetta Predictions human pricing
XM_001078310 Rosetta Predictions rat pricing
XM_573600 Rosetta Predictions rat pricing
NM_026667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182352 predicted 430
2 SASI_Hs01_00182353 predicted 213
3 SASI_Hs01_00182354 predicted 654
4 SASI_Hs01_00182355 predicted 659
5 SASI_Hs01_00182356 predicted 1741
6 SASI_Hs01_00182357 predicted 614
7 SASI_Hs01_00182358 predicted 648
8 SASI_Hs01_00182359 predicted 226
9 SASI_Hs01_00182360 predicted 939
10 SASI_Hs02_00363529 predicted 1680
11 SASI_Hs01_00182361 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360320 predicted 697
2 SASI_Rn02_00360321 predicted 867
3 SASI_Rn02_00360322 predicted 1510
4 SASI_Rn02_00360323 predicted 449
5 SASI_Rn02_00360324 predicted 1711
6 SASI_Rn02_00360325 predicted 877
7 SASI_Rn02_00360326 predicted 1549
8 SASI_Rn02_00360327 predicted 1606
9 SASI_Rn02_00360328 predicted 738
10 SASI_Rn02_00360329 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400555 predicted 713
2 SASI_Rn02_00400556 predicted 883
3 SASI_Rn02_00400557 predicted 1523
4 SASI_Rn02_00400558 predicted 460
5 SASI_Rn02_00400559 predicted 1726
6 SASI_Rn02_00400560 predicted 891
7 SASI_Rn02_00400561 predicted 1565
8 SASI_Rn02_00400562 predicted 1614
9 SASI_Rn02_00400563 predicted 753
10 SASI_Rn02_00400564 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330664 predicted 1766
2 SASI_Mm02_00330665 predicted 1772
3 SASI_Mm01_00118958 predicted 1638
4 SASI_Mm01_00118959 predicted 947
5 SASI_Mm01_00118960 predicted 767
6 SASI_Mm01_00118961 predicted 1621
7 SASI_Mm01_00118962 predicted 1674
8 SASI_Mm01_00118964 predicted 1017
9 SASI_Mm02_00330666 predicted 489
10 SASI_Mm02_00330667 predicted 433
11 SASI_Mm01_00118955 predicted 1740
12 SASI_Mm01_00118956 predicted 489
13 SASI_Mm01_00118957 predicted 1735
14 SASI_Mm01_00118963 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138389
FAM114A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 114, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138389.1-272s1c1
Sequence:CCGGGCATTGTGATTCAGCTGCAGTCTCGAGACTGCAGCTGAATCACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1557s1c1
Sequence:CCGGCAGCTTCATAAAGTAGCAGAACTCGAGTTCTGCTACTTTATGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-654s1c1
Sequence:CCGGCTACGGATTCATGGTGTAAATCTCGAGATTTACACCATGAATCCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-261s1c1
Sequence:CCGGGATGCAGAAGTGCATTGTGATCTCGAGATCACAATGCACTTCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1440s1c1
Sequence:CCGGGAGAAATCTCAAGACCCTCAACTCGAGTTGAGGGTCTTGAGATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1086s1c1
Sequence:CCGGGCCCTGGAAATTCTGTCCAATCTCGAGATTGGACAGAATTTCCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138389.2-1616s21c1
Sequence:CCGGGAGGTAACAGCGCGCTGTATTCTCGAGAATACAGCGCGCTGTTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138389.2-1801s21c1
Sequence:CCGGCAAGAAGGCCGAGGTCCTTAACTCGAGTTAAGGACCTCGGCCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138389.2-2247s21c1
Sequence:CCGGCCTGGTTAAGCATGCTATATTCTCGAGAATATAGCATGCTTAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138389.2-1995s21c1
Sequence:CCGGTGCCTCAATATGTACCATTTACTCGAGTAAATGGTACATATTGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138389
FAM114A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 114, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138389.1-272s1c1
Sequence:CCGGGCATTGTGATTCAGCTGCAGTCTCGAGACTGCAGCTGAATCACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1557s1c1
Sequence:CCGGCAGCTTCATAAAGTAGCAGAACTCGAGTTCTGCTACTTTATGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-654s1c1
Sequence:CCGGCTACGGATTCATGGTGTAAATCTCGAGATTTACACCATGAATCCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-261s1c1
Sequence:CCGGGATGCAGAAGTGCATTGTGATCTCGAGATCACAATGCACTTCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1440s1c1
Sequence:CCGGGAGAAATCTCAAGACCCTCAACTCGAGTTGAGGGTCTTGAGATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1086s1c1
Sequence:CCGGGCCCTGGAAATTCTGTCCAATCTCGAGATTGGACAGAATTTCCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138389.2-1616s21c1
Sequence:CCGGGAGGTAACAGCGCGCTGTATTCTCGAGAATACAGCGCGCTGTTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138389.2-1801s21c1
Sequence:CCGGCAAGAAGGCCGAGGTCCTTAACTCGAGTTAAGGACCTCGGCCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138389.2-2247s21c1
Sequence:CCGGCCTGGTTAAGCATGCTATATTCTCGAGAATATAGCATGCTTAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138389.2-1995s21c1
Sequence:CCGGTGCCTCAATATGTACCATTTACTCGAGTAAATGGTACATATTGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138389
FAM114A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 114, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138389.1-272s1c1
Sequence:CCGGGCATTGTGATTCAGCTGCAGTCTCGAGACTGCAGCTGAATCACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1557s1c1
Sequence:CCGGCAGCTTCATAAAGTAGCAGAACTCGAGTTCTGCTACTTTATGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-654s1c1
Sequence:CCGGCTACGGATTCATGGTGTAAATCTCGAGATTTACACCATGAATCCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-261s1c1
Sequence:CCGGGATGCAGAAGTGCATTGTGATCTCGAGATCACAATGCACTTCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1440s1c1
Sequence:CCGGGAGAAATCTCAAGACCCTCAACTCGAGTTGAGGGTCTTGAGATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138389.1-1086s1c1
Sequence:CCGGGCCCTGGAAATTCTGTCCAATCTCGAGATTGGACAGAATTTCCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138389.2-1616s21c1
Sequence:CCGGGAGGTAACAGCGCGCTGTATTCTCGAGAATACAGCGCGCTGTTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138389.2-1801s21c1
Sequence:CCGGCAAGAAGGCCGAGGTCCTTAACTCGAGTTAAGGACCTCGGCCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138389.2-2247s21c1
Sequence:CCGGCCTGGTTAAGCATGCTATATTCTCGAGAATATAGCATGCTTAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138389.2-1995s21c1
Sequence:CCGGTGCCTCAATATGTACCATTTACTCGAGTAAATGGTACATATTGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026667
VALIDATED
FAM114A1 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 114, member A1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1193s1c1
Sequence:CCGGCAAACTCAATAAGGCCATGAACTCGAGTTCATGGCCTTATTGAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1972s1c1
Sequence:CCGGGCAGTTCATTCACAAATGTATCTCGAGATACATTTGTGAATGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1537s1c1
Sequence:CCGGCCTCCTTATCGAAGAAGTTTACTCGAGTAAACTTCTTCGATAAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026667.2-1414s1c1
Sequence:CCGGGCTGCATTGAACAGCTACATACTCGAGTATGTAGCTGTTCAATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1525s1c1
Sequence:CCGGGCAATGAAGTAACCTCCTTATCTCGAGATAAGGAGGTTACTTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026667.2-1763s1c1
Sequence:CCGGGCCACATCTCTTCACTACATACTCGAGTATGTAGTGAAGAGATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026667.3-1775s1c1
Sequence:CCGGCAGATTGCAGCTAGTTCAATACTCGAGTATTGAACTAGCTGCAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026667.3-2037s1c1
Sequence:CCGGCCTGGTCAACCAGACTATATTCTCGAGAATATAGTCTGGTTGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026667
VALIDATED
FAM114A1 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 114, member A1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1193s1c1
Sequence:CCGGCAAACTCAATAAGGCCATGAACTCGAGTTCATGGCCTTATTGAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1972s1c1
Sequence:CCGGGCAGTTCATTCACAAATGTATCTCGAGATACATTTGTGAATGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1537s1c1
Sequence:CCGGCCTCCTTATCGAAGAAGTTTACTCGAGTAAACTTCTTCGATAAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026667.2-1414s1c1
Sequence:CCGGGCTGCATTGAACAGCTACATACTCGAGTATGTAGCTGTTCAATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1525s1c1
Sequence:CCGGGCAATGAAGTAACCTCCTTATCTCGAGATAAGGAGGTTACTTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026667.2-1763s1c1
Sequence:CCGGGCCACATCTCTTCACTACATACTCGAGTATGTAGTGAAGAGATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026667.3-1775s1c1
Sequence:CCGGCAGATTGCAGCTAGTTCAATACTCGAGTATTGAACTAGCTGCAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026667.3-2037s1c1
Sequence:CCGGCCTGGTCAACCAGACTATATTCTCGAGAATATAGTCTGGTTGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026667
VALIDATED
FAM114A1 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 114, member A1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1193s1c1
Sequence:CCGGCAAACTCAATAAGGCCATGAACTCGAGTTCATGGCCTTATTGAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1972s1c1
Sequence:CCGGGCAGTTCATTCACAAATGTATCTCGAGATACATTTGTGAATGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1537s1c1
Sequence:CCGGCCTCCTTATCGAAGAAGTTTACTCGAGTAAACTTCTTCGATAAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026667.2-1414s1c1
Sequence:CCGGGCTGCATTGAACAGCTACATACTCGAGTATGTAGCTGTTCAATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026667.2-1525s1c1
Sequence:CCGGGCAATGAAGTAACCTCCTTATCTCGAGATAAGGAGGTTACTTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193979    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026667.2-1763s1c1
Sequence:CCGGGCCACATCTCTTCACTACATACTCGAGTATGTAGTGAAGAGATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026667.3-1775s1c1
Sequence:CCGGCAGATTGCAGCTAGTTCAATACTCGAGTATTGAACTAGCTGCAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026667.3-2037s1c1
Sequence:CCGGCCTGGTCAACCAGACTATATTCTCGAGAATATAGTCTGGTTGACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)