EMAIL THIS PAGE TO A FRIEND

FAM114A2

family with sequence similarity 114, member A2

113 Gene Product Result for
Synonyms: 133K02 C5orf3
UniProtKB ID: Q9NRY5, B2R8D8, Q9H7E0
Gene ID:
Mouse(67726) family with sequence similarity 114, member A2
Rat(303155) family with sequence similarity 114, member A2
domestic guinea pig(100727323) family with sequence similarity 114, member A2
naked mole-rat(101724007) family with sequence similarity 114, member A2
sheep(101109013) family with sequence similarity 114, member A2
chicken(416262) family with sequence similarity 114, member A2
domestic cat(101083656) family with sequence similarity 114, member A2
cow(511198) family with sequence similarity 114, member A2
dog(489167) family with sequence similarity 114, member A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046571 MISSION® esiRNA esiRNA human FAM114A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018691 Rosetta Predictions human pricing
XM_220442 Rosetta Predictions rat pricing
NM_026342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194813 predicted 1209
2 SASI_Hs01_00194814 predicted 695
3 SASI_Hs02_00352215 predicted 1589
4 SASI_Hs01_00194815 predicted 293
5 SASI_Hs01_00194816 predicted 882
6 SASI_Hs01_00194817 predicted 765
7 SASI_Hs01_00194819 predicted 539
8 SASI_Hs01_00194820 predicted 549
9 SASI_Hs01_00194821 predicted 681
10 SASI_Hs01_00194822 predicted 637
11 SASI_Hs01_00194818 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379281 predicted 1554
2 SASI_Rn02_00379282 predicted 1516
3 SASI_Rn02_00379283 predicted 1791
4 SASI_Rn02_00379284 predicted 1786
5 SASI_Rn02_00379285 predicted 1642
6 SASI_Rn02_00379286 predicted 1548
7 SASI_Rn02_00379287 predicted 1598
8 SASI_Rn02_00379288 predicted 1818
9 SASI_Rn02_00379289 predicted 1483
10 SASI_Rn02_00379290 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041963 predicted 1409
2 SASI_Mm01_00041964 predicted 1175
3 SASI_Mm01_00041965 predicted 800
4 SASI_Mm01_00041966 predicted 809
5 SASI_Mm01_00041967 predicted 567
6 SASI_Mm01_00041968 predicted 815
7 SASI_Mm01_00041969 predicted 567
8 SASI_Mm01_00041970 predicted 1373
9 SASI_Mm01_00041971 predicted 1018
10 SASI_Mm01_00041972 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018691
VALIDATED
FAM114A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 114, member A2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018691.2-1803s21c1
Sequence:CCGGCCAGTTGTTGTAATTCATAAACTCGAGTTTATGAATTACAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-883s21c1
Sequence:CCGGAGGTGAAATCTATCCTTAATTCTCGAGAATTAAGGATAGATTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-1452s21c1
Sequence:CCGGCCATTAATCACTGCAGTATTTCTCGAGAAATACTGCAGTGATTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018691.2-1967s21c1
Sequence:CCGGATGGATATAACTGGTTGATAACTCGAGTTATCAACCAGTTATATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-1341s21c1
Sequence:CCGGACTCTTTCCCAGATGACAATTCTCGAGAATTGTCATCTGGGAAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-691s21c1
Sequence:CCGGAGGGTCTGATGAACCGAAATGCTCGAGCATTTCGGTTCATCAGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018691.1-2932s1c1
Sequence:CCGGCAAAGGAATGTTGAAGCTGTTCTCGAGAACAGCTTCAACATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018691.1-707s1c1
Sequence:CCGGGAGAGTAAATCAGAACCTGTACTCGAGTACAGGTTCTGATTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-763s1c1
Sequence:CCGGCAGTGATCTTGAGACTTCAAACTCGAGTTTGAAGTCTCAAGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-2688s1c1
Sequence:CCGGGAGGAGAAACTTGTAGACTATCTCGAGATAGTCTACAAGTTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-2083s1c1
Sequence:CCGGCCAGAAACCTTTGTTAGAACACTCGAGTGTTCTAACAAAGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018691
VALIDATED
FAM114A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 114, member A2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018691.2-1803s21c1
Sequence:CCGGCCAGTTGTTGTAATTCATAAACTCGAGTTTATGAATTACAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-883s21c1
Sequence:CCGGAGGTGAAATCTATCCTTAATTCTCGAGAATTAAGGATAGATTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-1452s21c1
Sequence:CCGGCCATTAATCACTGCAGTATTTCTCGAGAAATACTGCAGTGATTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018691.2-1967s21c1
Sequence:CCGGATGGATATAACTGGTTGATAACTCGAGTTATCAACCAGTTATATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-1341s21c1
Sequence:CCGGACTCTTTCCCAGATGACAATTCTCGAGAATTGTCATCTGGGAAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-691s21c1
Sequence:CCGGAGGGTCTGATGAACCGAAATGCTCGAGCATTTCGGTTCATCAGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018691.1-2932s1c1
Sequence:CCGGCAAAGGAATGTTGAAGCTGTTCTCGAGAACAGCTTCAACATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018691.1-707s1c1
Sequence:CCGGGAGAGTAAATCAGAACCTGTACTCGAGTACAGGTTCTGATTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-763s1c1
Sequence:CCGGCAGTGATCTTGAGACTTCAAACTCGAGTTTGAAGTCTCAAGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-2688s1c1
Sequence:CCGGGAGGAGAAACTTGTAGACTATCTCGAGATAGTCTACAAGTTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-2083s1c1
Sequence:CCGGCCAGAAACCTTTGTTAGAACACTCGAGTGTTCTAACAAAGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018691
VALIDATED
FAM114A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 114, member A2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018691.2-1803s21c1
Sequence:CCGGCCAGTTGTTGTAATTCATAAACTCGAGTTTATGAATTACAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-883s21c1
Sequence:CCGGAGGTGAAATCTATCCTTAATTCTCGAGAATTAAGGATAGATTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-1452s21c1
Sequence:CCGGCCATTAATCACTGCAGTATTTCTCGAGAAATACTGCAGTGATTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018691.2-1967s21c1
Sequence:CCGGATGGATATAACTGGTTGATAACTCGAGTTATCAACCAGTTATATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-1341s21c1
Sequence:CCGGACTCTTTCCCAGATGACAATTCTCGAGAATTGTCATCTGGGAAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018691.2-691s21c1
Sequence:CCGGAGGGTCTGATGAACCGAAATGCTCGAGCATTTCGGTTCATCAGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018691.1-2932s1c1
Sequence:CCGGCAAAGGAATGTTGAAGCTGTTCTCGAGAACAGCTTCAACATTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018691.1-707s1c1
Sequence:CCGGGAGAGTAAATCAGAACCTGTACTCGAGTACAGGTTCTGATTTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-763s1c1
Sequence:CCGGCAGTGATCTTGAGACTTCAAACTCGAGTTTGAAGTCTCAAGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-2688s1c1
Sequence:CCGGGAGGAGAAACTTGTAGACTATCTCGAGATAGTCTACAAGTTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018691.1-2083s1c1
Sequence:CCGGCCAGAAACCTTTGTTAGAACACTCGAGTGTTCTAACAAAGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026342
VALIDATED
FAM114A2 MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 114, member A2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-1023s21c1
Sequence:CCGGCAAGAAATACAGCCTACAAATCTCGAGATTTGTAGGCTGTATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-803s21c1
Sequence:CCGGGAAAGTGAGATAAAGGTGAAACTCGAGTTTCACCTTTATCTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-334s21c1
Sequence:CCGGTACAGTAGGACAAGGTATTTCCTCGAGGAAATACCTTGTCCTACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-1961s21c1
Sequence:CCGGGCTTTCTCCTTTCCAGAATAACTCGAGTTATTCTGGAAAGGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026342.2-1191s21c1
Sequence:CCGGGCTCAATAGAATTGTTCCACACTCGAGTGTGGAACAATTCTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1974s1c1
Sequence:CCGGCCAGAATAAAGCCTGTGGCTTCTCGAGAAGCCACAGGCTTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1962s1c1
Sequence:CCGGGCTTTCTCCTTTCCAGAATAACTCGAGTTATTCTGGAAAGGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-804s1c1
Sequence:CCGGGAAAGTGAGATAAAGGTGAAACTCGAGTTTCACCTTTATCTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1192s1c1
Sequence:CCGGGCTCAATAGAATTGTTCCACACTCGAGTGTGGAACAATTCTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026342
VALIDATED
FAM114A2 MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 114, member A2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-1023s21c1
Sequence:CCGGCAAGAAATACAGCCTACAAATCTCGAGATTTGTAGGCTGTATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-803s21c1
Sequence:CCGGGAAAGTGAGATAAAGGTGAAACTCGAGTTTCACCTTTATCTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-334s21c1
Sequence:CCGGTACAGTAGGACAAGGTATTTCCTCGAGGAAATACCTTGTCCTACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-1961s21c1
Sequence:CCGGGCTTTCTCCTTTCCAGAATAACTCGAGTTATTCTGGAAAGGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026342.2-1191s21c1
Sequence:CCGGGCTCAATAGAATTGTTCCACACTCGAGTGTGGAACAATTCTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1974s1c1
Sequence:CCGGCCAGAATAAAGCCTGTGGCTTCTCGAGAAGCCACAGGCTTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1962s1c1
Sequence:CCGGGCTTTCTCCTTTCCAGAATAACTCGAGTTATTCTGGAAAGGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-804s1c1
Sequence:CCGGGAAAGTGAGATAAAGGTGAAACTCGAGTTTCACCTTTATCTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1192s1c1
Sequence:CCGGGCTCAATAGAATTGTTCCACACTCGAGTGTGGAACAATTCTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026342
VALIDATED
FAM114A2 MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 114, member A2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-1023s21c1
Sequence:CCGGCAAGAAATACAGCCTACAAATCTCGAGATTTGTAGGCTGTATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-803s21c1
Sequence:CCGGGAAAGTGAGATAAAGGTGAAACTCGAGTTTCACCTTTATCTCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-334s21c1
Sequence:CCGGTACAGTAGGACAAGGTATTTCCTCGAGGAAATACCTTGTCCTACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026342.2-1961s21c1
Sequence:CCGGGCTTTCTCCTTTCCAGAATAACTCGAGTTATTCTGGAAAGGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026342.2-1191s21c1
Sequence:CCGGGCTCAATAGAATTGTTCCACACTCGAGTGTGGAACAATTCTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1974s1c1
Sequence:CCGGCCAGAATAAAGCCTGTGGCTTCTCGAGAAGCCACAGGCTTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1962s1c1
Sequence:CCGGGCTTTCTCCTTTCCAGAATAACTCGAGTTATTCTGGAAAGGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-804s1c1
Sequence:CCGGGAAAGTGAGATAAAGGTGAAACTCGAGTTTCACCTTTATCTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026342.1-1192s1c1
Sequence:CCGGGCTCAATAGAATTGTTCCACACTCGAGTGTGGAACAATTCTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks