EMAIL THIS PAGE TO A FRIEND

FAM115A

family with sequence similarity 115, member A

UniProtKB ID: Q9Y4C2, A8K6E0, Q75KM8, Q75KM9, Q7L665, Q9BW63
Gene ID:
Mouse(77574) family with sequence similarity 115, member A
Rat(362353) family with sequence similarity 115, member A
cow(533126) family with sequence similarity 115, member A
naked mole-rat(101707533) family with sequence similarity 115, member A
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017511 MISSION® esiRNA esiRNA targeting mouse Fam115a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014719 Rosetta Predictions human pricing
XM_001072497 Rosetta Predictions rat pricing
XM_342675 Rosetta Predictions rat pricing
NM_029930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346148 predicted 2619
2 SASI_Hs02_00346149 predicted 2982
3 SASI_Hs01_00021361 predicted 202
4 SASI_Hs01_00021363 predicted 733
5 SASI_Hs01_00021364 predicted 2267
6 SASI_Hs01_00021365 predicted 1648
7 SASI_Hs01_00021366 predicted 1743
8 SASI_Hs01_00021367 predicted 1349
9 SASI_Hs01_00021368 predicted 1298
10 SASI_Hs02_00346150 predicted 1494
11 SASI_Hs01_00021360 predicted 506
12 SASI_Hs01_00021362 predicted 226
13 SASI_Hs01_00021369 predicted 2962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339413 predicted 1672
2 SASI_Rn02_00339414 predicted 334
3 SASI_Rn02_00339415 predicted 1947
4 SASI_Rn02_00339416 predicted 2633
5 SASI_Rn02_00339417 predicted 3082
6 SASI_Rn02_00339418 predicted 958
7 SASI_Rn02_00339419 predicted 2864
8 SASI_Rn02_00339420 predicted 1751
9 SASI_Rn02_00339421 predicted 2941
10 SASI_Rn02_00339422 predicted 3008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394641 predicted 1652
2 SASI_Rn02_00394642 predicted 313
3 SASI_Rn02_00394643 predicted 1928
4 SASI_Rn02_00394644 predicted 2613
5 SASI_Rn02_00394645 predicted 3060
6 SASI_Rn02_00394646 predicted 937
7 SASI_Rn02_00394647 predicted 2843
8 SASI_Rn02_00394648 predicted 1728
9 SASI_Rn02_00394649 predicted 2922
10 SASI_Rn02_00394650 predicted 2981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031293 predicted 1323
2 SASI_Mm01_00031294 predicted 846
3 SASI_Mm01_00031295 predicted 1781
4 SASI_Mm01_00031296 predicted 2848
5 SASI_Mm01_00031297 predicted 935
6 SASI_Mm02_00336210 predicted 1725
7 SASI_Mm01_00031298 predicted 1585
8 SASI_Mm01_00031299 predicted 404
9 SASI_Mm01_00031300 predicted 211
10 SASI_Mm01_00031301 predicted 2874
11 SASI_Mm01_00031302 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014719
FAM115A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 115, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-1567s1c1
Sequence:CCGGCCGAGAGAACCCTGTTATCAACTCGAGTTGATAACAGGGTTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-819s1c1
Sequence:CCGGGCAACTCGGATTGTTTCCCATCTCGAGATGGGAAACAATCCGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-1396s1c1
Sequence:CCGGCCAGGTTATAATGGGCAGGAACTCGAGTTCCTGCCCATTATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014719.1-3017s1c1
Sequence:CCGGGCATGATAATGAAAGAGTGAACTCGAGTTCACTCTTTCATTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014719.1-3305s21c1
Sequence:CCGGTTCTCTTCTAGTGGAAATAAGCTCGAGCTTATTTCCACTAGAAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1741s21c1
Sequence:CCGGCAATCCAGGCACCAGATATTGCTCGAGCAATATCTGGTGCCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014719.1-3193s21c1
Sequence:CCGGCCACTATTGATACCAGTTAAACTCGAGTTTAACTGGTATCAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-2615s21c1
Sequence:CCGGACCGCACTGGAAACGTATTTACTCGAGTAAATACGTTTCCAGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1387s21c1
Sequence:CCGGGGCCGAGTTCCAGGTTATAATCTCGAGATTATAACCTGGAACTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1782s21c1
Sequence:CCGGACATACCTGGAAGGCAAATTACTCGAGTAATTTGCCTTCCAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014719
FAM115A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 115, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-1567s1c1
Sequence:CCGGCCGAGAGAACCCTGTTATCAACTCGAGTTGATAACAGGGTTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-819s1c1
Sequence:CCGGGCAACTCGGATTGTTTCCCATCTCGAGATGGGAAACAATCCGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-1396s1c1
Sequence:CCGGCCAGGTTATAATGGGCAGGAACTCGAGTTCCTGCCCATTATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014719.1-3017s1c1
Sequence:CCGGGCATGATAATGAAAGAGTGAACTCGAGTTCACTCTTTCATTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014719.1-3305s21c1
Sequence:CCGGTTCTCTTCTAGTGGAAATAAGCTCGAGCTTATTTCCACTAGAAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1741s21c1
Sequence:CCGGCAATCCAGGCACCAGATATTGCTCGAGCAATATCTGGTGCCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014719.1-3193s21c1
Sequence:CCGGCCACTATTGATACCAGTTAAACTCGAGTTTAACTGGTATCAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-2615s21c1
Sequence:CCGGACCGCACTGGAAACGTATTTACTCGAGTAAATACGTTTCCAGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1387s21c1
Sequence:CCGGGGCCGAGTTCCAGGTTATAATCTCGAGATTATAACCTGGAACTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1782s21c1
Sequence:CCGGACATACCTGGAAGGCAAATTACTCGAGTAATTTGCCTTCCAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014719
FAM115A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 115, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-1567s1c1
Sequence:CCGGCCGAGAGAACCCTGTTATCAACTCGAGTTGATAACAGGGTTCTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-819s1c1
Sequence:CCGGGCAACTCGGATTGTTTCCCATCTCGAGATGGGAAACAATCCGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014719.1-1396s1c1
Sequence:CCGGCCAGGTTATAATGGGCAGGAACTCGAGTTCCTGCCCATTATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014719.1-3017s1c1
Sequence:CCGGGCATGATAATGAAAGAGTGAACTCGAGTTCACTCTTTCATTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014719.1-3305s21c1
Sequence:CCGGTTCTCTTCTAGTGGAAATAAGCTCGAGCTTATTTCCACTAGAAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1741s21c1
Sequence:CCGGCAATCCAGGCACCAGATATTGCTCGAGCAATATCTGGTGCCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014719.1-3193s21c1
Sequence:CCGGCCACTATTGATACCAGTTAAACTCGAGTTTAACTGGTATCAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-2615s21c1
Sequence:CCGGACCGCACTGGAAACGTATTTACTCGAGTAAATACGTTTCCAGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1387s21c1
Sequence:CCGGGGCCGAGTTCCAGGTTATAATCTCGAGATTATAACCTGGAACTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014719.1-1782s21c1
Sequence:CCGGACATACCTGGAAGGCAAATTACTCGAGTAATTTGCCTTCCAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029930
FAM115A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 115, member A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1587s1c1
Sequence:CCGGCGGTCATCAATGACTGTTGTACTCGAGTACAACAGTCATTGATGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029930.1-3026s1c1
Sequence:CCGGCCTGTGTCTTATTACCGACTTCTCGAGAAGTCGGTAATAAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1869s1c1
Sequence:CCGGGTCATACTGATGATCTGACAACTCGAGTTGTCAGATCATCAGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1672s1c1
Sequence:CCGGCCCAGAAATTGAAGACGTGTACTCGAGTACACGTCTTCAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029930
FAM115A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 115, member A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1587s1c1
Sequence:CCGGCGGTCATCAATGACTGTTGTACTCGAGTACAACAGTCATTGATGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029930.1-3026s1c1
Sequence:CCGGCCTGTGTCTTATTACCGACTTCTCGAGAAGTCGGTAATAAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1869s1c1
Sequence:CCGGGTCATACTGATGATCTGACAACTCGAGTTGTCAGATCATCAGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1672s1c1
Sequence:CCGGCCCAGAAATTGAAGACGTGTACTCGAGTACACGTCTTCAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029930
FAM115A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 115, member A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1587s1c1
Sequence:CCGGCGGTCATCAATGACTGTTGTACTCGAGTACAACAGTCATTGATGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029930.1-3026s1c1
Sequence:CCGGCCTGTGTCTTATTACCGACTTCTCGAGAAGTCGGTAATAAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1869s1c1
Sequence:CCGGGTCATACTGATGATCTGACAACTCGAGTTGTCAGATCATCAGTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029930.1-1672s1c1
Sequence:CCGGCCCAGAAATTGAAGACGTGTACTCGAGTACACGTCTTCAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks