EMAIL THIS PAGE TO A FRIEND

FAM115C

family with sequence similarity 115, member C

48 Gene Product Result for
Synonyms: FAM139A
UniProtKB ID: A6NFQ2, B4DK02, Q14D25, Q17RQ4, Q8IWQ0, Q8NF84
Gene ID:
Mouse(232748) family with sequence similarity 115, member C
Rat(680422) family with sequence similarity 115, member C
cow(510320) family with sequence similarity 115, member C
domestic cat(101082993) family with sequence similarity 115, member C
domestic guinea pig(100725052) family with sequence similarity 115, member C
naked mole-rat(101708729) family with sequence similarity 115, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173678 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173678 Rosetta Predictions human pricing
XM_001057103 Rosetta Predictions rat pricing
NM_146174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368614 predicted 441
2 SASI_Hs01_00059179 predicted 1327
3 SASI_Hs02_00368615 predicted 643
4 SASI_Hs01_00059180 predicted 2395
5 SASI_Hs01_00059181 predicted 1971
6 SASI_Hs01_00059182 predicted 2197
7 SASI_Hs01_00059183 predicted 579
8 SASI_Hs01_00059184 predicted 592
9 SASI_Hs01_00059185 predicted 1317
10 SASI_Hs01_00059186 predicted 2082
11 SASI_Hs01_00059178 predicted 1671
12 SASI_Hs01_00059187 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285419 predicted 858
2 SASI_Rn02_00285420 predicted 1509
3 SASI_Rn02_00285421 predicted 576
4 SASI_Rn02_00285422 predicted 538
5 SASI_Rn02_00285423 predicted 2807
6 SASI_Rn02_00285424 predicted 1223
7 SASI_Rn02_00285425 predicted 1567
8 SASI_Rn02_00285426 predicted 921
9 SASI_Rn02_00285427 predicted 927
10 SASI_Rn02_00285428 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172469 predicted 713
2 SASI_Mm02_00341874 predicted 1701
3 SASI_Mm01_00172470 predicted 1043
4 SASI_Mm01_00172471 predicted 1699
5 SASI_Mm01_00172472 predicted 1627
6 SASI_Mm01_00172473 predicted 3004
7 SASI_Mm01_00172474 predicted 1781
8 SASI_Mm01_00172475 predicted 2986
9 SASI_Mm01_00172476 predicted 1162
10 SASI_Mm01_00172477 predicted 1615
11 SASI_Mm01_00172478 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146174
VALIDATED
FAM115C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 115, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-1762s21c1
Sequence:CCGGCCATTACCGTGGAGATCAATGCTCGAGCATTGATCTCCACGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-3393s21c1
Sequence:CCGGGCGATAGATTGTAGATCTTATCTCGAGATAAGATCTACAATCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-492s21c1
Sequence:CCGGCTACGTGGCTCTGGGATAAATCTCGAGATTTATCCCAGAGCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-730s21c1
Sequence:CCGGCAGATGTCTATGGAGATATAACTCGAGTTATATCTCCATAGACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-1151s21c1
Sequence:CCGGGTCCCATTTGACCGATGATATCTCGAGATATCATCGGTCAAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146174
VALIDATED
FAM115C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 115, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-1762s21c1
Sequence:CCGGCCATTACCGTGGAGATCAATGCTCGAGCATTGATCTCCACGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-3393s21c1
Sequence:CCGGGCGATAGATTGTAGATCTTATCTCGAGATAAGATCTACAATCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-492s21c1
Sequence:CCGGCTACGTGGCTCTGGGATAAATCTCGAGATTTATCCCAGAGCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-730s21c1
Sequence:CCGGCAGATGTCTATGGAGATATAACTCGAGTTATATCTCCATAGACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-1151s21c1
Sequence:CCGGGTCCCATTTGACCGATGATATCTCGAGATATCATCGGTCAAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146174
VALIDATED
FAM115C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 115, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-1762s21c1
Sequence:CCGGCCATTACCGTGGAGATCAATGCTCGAGCATTGATCTCCACGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-3393s21c1
Sequence:CCGGGCGATAGATTGTAGATCTTATCTCGAGATAAGATCTACAATCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-492s21c1
Sequence:CCGGCTACGTGGCTCTGGGATAAATCTCGAGATTTATCCCAGAGCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-730s21c1
Sequence:CCGGCAGATGTCTATGGAGATATAACTCGAGTTATATCTCCATAGACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146174.1-1151s21c1
Sequence:CCGGGTCCCATTTGACCGATGATATCTCGAGATATCATCGGTCAAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173678
FAM115C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 115, member C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-2553s1c1
Sequence:CCGGCCTGGAAACATATCTACAGGTCTCGAGACCTGTAGATATGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-1317s1c1
Sequence:CCGGGCTCTCTCAATTCCAGGCTATCTCGAGATAGCCTGGAATTGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-2399s1c1
Sequence:CCGGCCTGTAACCTTTGGTCAGTCTCTCGAGAGACTGACCAAAGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-1047s1c1
Sequence:CCGGGAACAGCGACTTGTGTGTCTACTCGAGTAGACACACAAGTCGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-2400s1c1
Sequence:CCGGCTGTAACCTTTGGTCAGTCTACTCGAGTAGACTGACCAAAGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-145s1c1
Sequence:CCGGCCCAGTGAACTCCTTCTTATTCTCGAGAATAAGAAGGAGTTCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173678.1-2766s1c1
Sequence:CCGGGTCTCACTCACCTTCTGATTTCTCGAGAAATCAGAAGGTGAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-1656s1c1
Sequence:CCGGCGTGGAGATCAATGGAATCAACTCGAGTTGATTCCATTGATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-1375s1c1
Sequence:CCGGCTGGCAAAGTTGAGAGTTGATCTCGAGATCAACTCTCAACTTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-2280s1c1
Sequence:CCGGGAAGGAGATCATCAATGAGATCTCGAGATCTCATTGATGATCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173678
FAM115C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 115, member C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-2553s1c1
Sequence:CCGGCCTGGAAACATATCTACAGGTCTCGAGACCTGTAGATATGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-1317s1c1
Sequence:CCGGGCTCTCTCAATTCCAGGCTATCTCGAGATAGCCTGGAATTGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-2399s1c1
Sequence:CCGGCCTGTAACCTTTGGTCAGTCTCTCGAGAGACTGACCAAAGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-1047s1c1
Sequence:CCGGGAACAGCGACTTGTGTGTCTACTCGAGTAGACACACAAGTCGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-2400s1c1
Sequence:CCGGCTGTAACCTTTGGTCAGTCTACTCGAGTAGACTGACCAAAGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-145s1c1
Sequence:CCGGCCCAGTGAACTCCTTCTTATTCTCGAGAATAAGAAGGAGTTCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173678.1-2766s1c1
Sequence:CCGGGTCTCACTCACCTTCTGATTTCTCGAGAAATCAGAAGGTGAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-1656s1c1
Sequence:CCGGCGTGGAGATCAATGGAATCAACTCGAGTTGATTCCATTGATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-1375s1c1
Sequence:CCGGCTGGCAAAGTTGAGAGTTGATCTCGAGATCAACTCTCAACTTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-2280s1c1
Sequence:CCGGGAAGGAGATCATCAATGAGATCTCGAGATCTCATTGATGATCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173678
FAM115C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 115, member C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-2553s1c1
Sequence:CCGGCCTGGAAACATATCTACAGGTCTCGAGACCTGTAGATATGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-1317s1c1
Sequence:CCGGGCTCTCTCAATTCCAGGCTATCTCGAGATAGCCTGGAATTGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-2399s1c1
Sequence:CCGGCCTGTAACCTTTGGTCAGTCTCTCGAGAGACTGACCAAAGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-1047s1c1
Sequence:CCGGGAACAGCGACTTGTGTGTCTACTCGAGTAGACACACAAGTCGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-2400s1c1
Sequence:CCGGCTGTAACCTTTGGTCAGTCTACTCGAGTAGACTGACCAAAGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-145s1c1
Sequence:CCGGCCCAGTGAACTCCTTCTTATTCTCGAGAATAAGAAGGAGTTCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173678.1-2766s1c1
Sequence:CCGGGTCTCACTCACCTTCTGATTTCTCGAGAAATCAGAAGGTGAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-1656s1c1
Sequence:CCGGCGTGGAGATCAATGGAATCAACTCGAGTTGATTCCATTGATCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173678.1-1375s1c1
Sequence:CCGGCTGGCAAAGTTGAGAGTTGATCTCGAGATCAACTCTCAACTTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173678.1-2280s1c1
Sequence:CCGGGAAGGAGATCATCAATGAGATCTCGAGATCTCATTGATGATCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks