EMAIL THIS PAGE TO A FRIEND

FAM117A

family with sequence similarity 117, member A

117 Gene Product Result for
UniProtKB ID: Q9C073
Gene ID:
Mouse(215512) family with sequence similarity 117, member A
Rat(497983) family with sequence similarity 117, member A
chicken(425529) family with sequence similarity 117, member A
dog(609175) family with sequence similarity 117, member A
domestic cat(101100768) family with sequence similarity 117, member A
cow(509931) family with sequence similarity 117, member A
domestic guinea pig(100716348) family with sequence similarity 117, member A
naked mole-rat(101696325) family with sequence similarity 117, member A
sheep(101118802) family with sequence similarity 117, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030802 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030802 Rosetta Predictions human pricing
NM_001109039 Rosetta Predictions rat pricing
NM_172543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244314 predicted 775
2 SASI_Hs01_00244316 predicted 1802
3 SASI_Hs01_00244319 predicted 1459
4 SASI_Hs01_00244320 predicted 1928
5 SASI_Hs01_00244321 predicted 1916
6 SASI_Hs02_00358364 predicted 1059
7 SASI_Hs02_00358365 predicted 1735
8 SASI_Hs01_00244322 predicted 1172
9 SASI_Hs01_00244323 predicted 1753
10 SASI_Hs02_00358366 predicted 362
11 SASI_Hs01_00244315 predicted 1556
12 SASI_Hs01_00244317 predicted 1066
13 SASI_Hs01_00244318 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244574 predicted 1033
2 SASI_Rn02_00244575 predicted 1144
3 SASI_Rn02_00244576 predicted 931
4 SASI_Rn02_00244577 predicted 1513
5 SASI_Rn02_00244578 predicted 1518
6 SASI_Rn02_00244579 predicted 935
7 SASI_Rn02_00244580 predicted 1036
8 SASI_Rn02_00244581 predicted 798
9 SASI_Rn02_00244582 predicted 1891
10 SASI_Rn02_00244583 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193440 predicted 1421
2 SASI_Mm01_00193441 predicted 801
3 SASI_Mm01_00193442 predicted 1844
4 SASI_Mm01_00193443 predicted 1221
5 SASI_Mm01_00193444 predicted 1602
6 SASI_Mm01_00193445 predicted 1799
7 SASI_Mm01_00193447 predicted 1678
8 SASI_Mm01_00193448 predicted 1804
9 SASI_Mm02_00344152 predicted 1780
10 SASI_Mm01_00193449 predicted 1621
11 SASI_Mm01_00193446 predicted 1653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172543
VALIDATED
FAM117A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 117, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-511s1c1
Sequence:CCGGGATCACCAAGTTGAAGCAGCACTCGAGTGCTGCTTCAACTTGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-1132s1c1
Sequence:CCGGCTTGACTTCCTGTCCTGACAACTCGAGTTGTCAGGACAGGAAGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-935s1c1
Sequence:CCGGGCATCCATCCACGGTAACAAACTCGAGTTTGTTACCGTGGATGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172543.1-1362s1c1
Sequence:CCGGCATCGGAAGAGTCTGTGCTTTCTCGAGAAAGCACAGACTCTTCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-1036s1c1
Sequence:CCGGCAATCACAGCTACGTCTTCAACTCGAGTTGAAGACGTAGCTGTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172543.2-1686s21c1
Sequence:CCGGGTGAGTCCAGATGACTTATAACTCGAGTTATAAGTCATCTGGACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-1035s21c1
Sequence:CCGGCAATCACAGCTACGTCTTCAACTCGAGTTGAAGACGTAGCTGTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-1226s21c1
Sequence:CCGGTGGGCTTCATCTTCCGTAATTCTCGAGAATTACGGAAGATGAAGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-510s21c1
Sequence:CCGGGATCACCAAGTTGAAGCAGCACTCGAGTGCTGCTTCAACTTGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-934s21c1
Sequence:CCGGGCATCCATCCACGGTAACAAACTCGAGTTTGTTACCGTGGATGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172543
VALIDATED
FAM117A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 117, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-511s1c1
Sequence:CCGGGATCACCAAGTTGAAGCAGCACTCGAGTGCTGCTTCAACTTGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-1132s1c1
Sequence:CCGGCTTGACTTCCTGTCCTGACAACTCGAGTTGTCAGGACAGGAAGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-935s1c1
Sequence:CCGGGCATCCATCCACGGTAACAAACTCGAGTTTGTTACCGTGGATGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172543.1-1362s1c1
Sequence:CCGGCATCGGAAGAGTCTGTGCTTTCTCGAGAAAGCACAGACTCTTCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-1036s1c1
Sequence:CCGGCAATCACAGCTACGTCTTCAACTCGAGTTGAAGACGTAGCTGTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172543.2-1686s21c1
Sequence:CCGGGTGAGTCCAGATGACTTATAACTCGAGTTATAAGTCATCTGGACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-1035s21c1
Sequence:CCGGCAATCACAGCTACGTCTTCAACTCGAGTTGAAGACGTAGCTGTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-1226s21c1
Sequence:CCGGTGGGCTTCATCTTCCGTAATTCTCGAGAATTACGGAAGATGAAGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-510s21c1
Sequence:CCGGGATCACCAAGTTGAAGCAGCACTCGAGTGCTGCTTCAACTTGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-934s21c1
Sequence:CCGGGCATCCATCCACGGTAACAAACTCGAGTTTGTTACCGTGGATGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172543
VALIDATED
FAM117A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 117, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-511s1c1
Sequence:CCGGGATCACCAAGTTGAAGCAGCACTCGAGTGCTGCTTCAACTTGGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-1132s1c1
Sequence:CCGGCTTGACTTCCTGTCCTGACAACTCGAGTTGTCAGGACAGGAAGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-935s1c1
Sequence:CCGGGCATCCATCCACGGTAACAAACTCGAGTTTGTTACCGTGGATGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172543.1-1362s1c1
Sequence:CCGGCATCGGAAGAGTCTGTGCTTTCTCGAGAAAGCACAGACTCTTCCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172543.1-1036s1c1
Sequence:CCGGCAATCACAGCTACGTCTTCAACTCGAGTTGAAGACGTAGCTGTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172543.2-1686s21c1
Sequence:CCGGGTGAGTCCAGATGACTTATAACTCGAGTTATAAGTCATCTGGACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-1035s21c1
Sequence:CCGGCAATCACAGCTACGTCTTCAACTCGAGTTGAAGACGTAGCTGTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-1226s21c1
Sequence:CCGGTGGGCTTCATCTTCCGTAATTCTCGAGAATTACGGAAGATGAAGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-510s21c1
Sequence:CCGGGATCACCAAGTTGAAGCAGCACTCGAGTGCTGCTTCAACTTGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172543.2-934s21c1
Sequence:CCGGGCATCCATCCACGGTAACAAACTCGAGTTTGTTACCGTGGATGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030802
VALIDATED
FAM117A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 117, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1839s1c1
Sequence:CCGGCCTCCAGGAGACCATAAGATACTCGAGTATCTTATGGTCTCCTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1170s1c1
Sequence:CCGGGACTTCCTGTCCTGACAAGAACTCGAGTTCTTGTCAGGACAGGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-549s1c1
Sequence:CCGGCAAGTTGAAGCAACAACTGCACTCGAGTGCAGTTGTTGCTTCAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1185s1c1
Sequence:CCGGCAAGAACAAAGTCCATTTCAACTCGAGTTGAAATGGACTTTGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030802.3-1635s21c1
Sequence:CCGGGTAGCTGGGCAGCTCACAATTCTCGAGAATTGTGAGCTGCCCAGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-1061s21c1
Sequence:CCGGATCATAGCTACATCTTCAAACCTCGAGGTTTGAAGATGTAGCTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030802.3-1744s21c1
Sequence:CCGGCTGTATAGGAGGCCCTTATTTCTCGAGAAATAAGGGCCTCCTATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-1249s21c1
Sequence:CCGGATGGGCTTCATCTTCCGTAACCTCGAGGTTACGGAAGATGAAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030802.3-318s21c1
Sequence:CCGGACTTCAGGTCCGGCGTACATTCTCGAGAATGTACGCCGGACCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-768s21c1
Sequence:CCGGGCTGCTGAGGATCCTTGATATCTCGAGATATCAAGGATCCTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030802
VALIDATED
FAM117A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 117, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1839s1c1
Sequence:CCGGCCTCCAGGAGACCATAAGATACTCGAGTATCTTATGGTCTCCTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1170s1c1
Sequence:CCGGGACTTCCTGTCCTGACAAGAACTCGAGTTCTTGTCAGGACAGGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-549s1c1
Sequence:CCGGCAAGTTGAAGCAACAACTGCACTCGAGTGCAGTTGTTGCTTCAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1185s1c1
Sequence:CCGGCAAGAACAAAGTCCATTTCAACTCGAGTTGAAATGGACTTTGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030802.3-1635s21c1
Sequence:CCGGGTAGCTGGGCAGCTCACAATTCTCGAGAATTGTGAGCTGCCCAGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-1061s21c1
Sequence:CCGGATCATAGCTACATCTTCAAACCTCGAGGTTTGAAGATGTAGCTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030802.3-1744s21c1
Sequence:CCGGCTGTATAGGAGGCCCTTATTTCTCGAGAAATAAGGGCCTCCTATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-1249s21c1
Sequence:CCGGATGGGCTTCATCTTCCGTAACCTCGAGGTTACGGAAGATGAAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030802.3-318s21c1
Sequence:CCGGACTTCAGGTCCGGCGTACATTCTCGAGAATGTACGCCGGACCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-768s21c1
Sequence:CCGGGCTGCTGAGGATCCTTGATATCTCGAGATATCAAGGATCCTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030802
VALIDATED
FAM117A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 117, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1839s1c1
Sequence:CCGGCCTCCAGGAGACCATAAGATACTCGAGTATCTTATGGTCTCCTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1170s1c1
Sequence:CCGGGACTTCCTGTCCTGACAAGAACTCGAGTTCTTGTCAGGACAGGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-549s1c1
Sequence:CCGGCAAGTTGAAGCAACAACTGCACTCGAGTGCAGTTGTTGCTTCAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_030802.2-1185s1c1
Sequence:CCGGCAAGAACAAAGTCCATTTCAACTCGAGTTGAAATGGACTTTGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030802.3-1635s21c1
Sequence:CCGGGTAGCTGGGCAGCTCACAATTCTCGAGAATTGTGAGCTGCCCAGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-1061s21c1
Sequence:CCGGATCATAGCTACATCTTCAAACCTCGAGGTTTGAAGATGTAGCTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030802.3-1744s21c1
Sequence:CCGGCTGTATAGGAGGCCCTTATTTCTCGAGAAATAAGGGCCTCCTATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-1249s21c1
Sequence:CCGGATGGGCTTCATCTTCCGTAACCTCGAGGTTACGGAAGATGAAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030802.3-318s21c1
Sequence:CCGGACTTCAGGTCCGGCGTACATTCTCGAGAATGTACGCCGGACCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030802.3-768s21c1
Sequence:CCGGGCTGCTGAGGATCCTTGATATCTCGAGATATCAAGGATCCTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)