EMAIL THIS PAGE TO A FRIEND

FAM117B

family with sequence similarity 117, member B

253 Gene Product Result for
Synonyms: ALS2CR13
UniProtKB ID: Q6P1L5, Q53QZ5, Q585T9, Q8N8W1, Q96Q34
Gene ID:
Mouse(72750) family with sequence similarity 117, member B
Rat(363236) family with sequence similarity 117, member B
sheep(101111259) family with sequence similarity 117, member B
naked mole-rat(101700660) family with sequence similarity 117, member B
domestic guinea pig(100712852) family with sequence similarity 117, member B
chicken(424088) family with sequence similarity 117, member B
dog(609222) family with sequence similarity 117, member B
cow(614932) family with sequence similarity 117, member B
domestic cat(101096589) family with sequence similarity 117, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089771 MISSION® esiRNA esiRNA human FAM117B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173511 Rosetta Predictions human pricing
NM_001108797 Rosetta Predictions rat pricing
NM_001003946 Rosetta Predictions mouse pricing
NM_001037725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368283 predicted 1007
2 SASI_Hs01_00037280 predicted 1117
3 SASI_Hs02_00368284 predicted 1008
4 SASI_Hs01_00037282 predicted 733
5 SASI_Hs01_00037283 predicted 786
6 SASI_Hs02_00368285 predicted 589
7 SASI_Hs01_00037285 predicted 1336
8 SASI_Hs01_00037286 predicted 1020
9 SASI_Hs01_00037287 predicted 718
10 SASI_Hs01_00037288 predicted 940
11 SASI_Hs01_00037279 predicted 668
12 SASI_Hs01_00037281 predicted 1518
13 SASI_Hs01_00037284 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242165 predicted 1156
2 SASI_Rn02_00242166 predicted 889
3 SASI_Rn02_00242167 predicted 1229
4 SASI_Rn02_00242168 predicted 1277
5 SASI_Rn02_00242169 predicted 1030
6 SASI_Rn02_00242170 predicted 840
7 SASI_Rn02_00242171 predicted 922
8 SASI_Rn02_00242172 predicted 1290
9 SASI_Rn02_00242173 predicted 1013
10 SASI_Rn02_00242174 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021359 predicted 1119
2 SASI_Mm01_00021360 predicted 916
3 SASI_Mm01_00021361 predicted 1229
4 SASI_Mm01_00021362 predicted 963
5 SASI_Mm01_00021363 predicted 599
6 SASI_Mm01_00021364 predicted 832
7 SASI_Mm01_00021365 predicted 1044
8 SASI_Mm01_00021366 predicted 372
9 SASI_Mm01_00021367 predicted 628
10 SASI_Mm01_00021368 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097682 predicted 1717
2 SASI_Mm01_00097683 predicted 1518
3 SASI_Mm01_00097684 predicted 1826
4 SASI_Mm01_00097685 predicted 1557
5 SASI_Mm01_00097686 predicted 1191
6 SASI_Mm01_00097687 predicted 1432
7 SASI_Mm01_00097688 predicted 1645
8 SASI_Mm01_00097689 predicted 971
9 SASI_Mm01_00097690 predicted 1228
10 SASI_Mm01_00097691 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037725
FAM117B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 117, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037725.2-1643s21c1
Sequence:CCGGCAAGGTGAATTTCATTCCTAACTCGAGTTAGGAATGAAATTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037725.2-3028s21c1
Sequence:CCGGGCTAGTTTCTTCTCCAACATTCTCGAGAATGTTGGAGAAGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037725.2-1182s21c1
Sequence:CCGGGAAGGGCTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037725.2-2375s21c1
Sequence:CCGGCCTCTGTTTCTTGTTTCCTTTCTCGAGAAAGGAAACAAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037725
FAM117B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 117, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037725.2-1643s21c1
Sequence:CCGGCAAGGTGAATTTCATTCCTAACTCGAGTTAGGAATGAAATTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037725.2-3028s21c1
Sequence:CCGGGCTAGTTTCTTCTCCAACATTCTCGAGAATGTTGGAGAAGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037725.2-1182s21c1
Sequence:CCGGGAAGGGCTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037725.2-2375s21c1
Sequence:CCGGCCTCTGTTTCTTGTTTCCTTTCTCGAGAAAGGAAACAAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037725
FAM117B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 117, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037725.2-1643s21c1
Sequence:CCGGCAAGGTGAATTTCATTCCTAACTCGAGTTAGGAATGAAATTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037725.2-3028s21c1
Sequence:CCGGGCTAGTTTCTTCTCCAACATTCTCGAGAATGTTGGAGAAGAAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037725.2-1182s21c1
Sequence:CCGGGAAGGGCTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037725.2-2375s21c1
Sequence:CCGGCCTCTGTTTCTTGTTTCCTTTCTCGAGAAAGGAAACAAGAAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173511
VALIDATED
FAM117B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 117, member B
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-1010s21c1
Sequence:CCGGTTGTTGATCCCAGAGATAAAGCTCGAGCTTTATCTCTGGGATCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-795s21c1
Sequence:CCGGGCAACTTATACCGCAAGATATCTCGAGATATCTTGCGGTATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-522s21c1
Sequence:CCGGGGGCAGTACAGATCAACTTAACTCGAGTTAAGTTGATCTGTACTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-677s21c1
Sequence:CCGGGTGCACTTATTCCTGTAATTCCTCGAGGAATTACAGGAATAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-4967s21c1
Sequence:CCGGAGACTAGGACTGGGTTATAAACTCGAGTTTATAACCCAGTCCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-3321s21c1
Sequence:CCGGTGCAGTTTAGAAGGTTAATATCTCGAGATATTAACCTTCTAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-630s21c1
Sequence:CCGGTGGCAACCATGCAGCTATTAACTCGAGTTAATAGCTGCATGGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-590s21c1
Sequence:CCGGGTCGGCATCATCGAGATAAAGCTCGAGCTTTATCTCGATGATGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-563s21c1
Sequence:CCGGAGCAGTTGCAGAGAAGTAAACCTCGAGGTTTACTTCTCTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173511.1-932s1c1
Sequence:CCGGGAACAATTCTCCTTTGCCCAACTCGAGTTGGGCAAAGGAGAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173511.1-1338s1c1
Sequence:CCGGGAACCAATTGAGGAAGCTGAACTCGAGTTCAGCTTCCTCAATTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173511.1-1860s1c1
Sequence:CCGGCCTCTGTTTCTTGTTCCCTTTCTCGAGAAAGGGAACAAGAAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173511.1-633s1c1
Sequence:CCGGGAAGGATTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173511.1-950s1c1
Sequence:CCGGCAAATATGCAACCTCACCAAACTCGAGTTTGGTGAGGTTGCATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173511.1-1824s1c1
Sequence:CCGGCGTAGCAAACAGGATATTCAACTCGAGTTGAATATCCTGTTTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173511.1-1719s1c1
Sequence:CCGGCCTTGCCAACATGATTCCTAACTCGAGTTAGGAATCATGTTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173511
VALIDATED
FAM117B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 117, member B
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-1010s21c1
Sequence:CCGGTTGTTGATCCCAGAGATAAAGCTCGAGCTTTATCTCTGGGATCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-795s21c1
Sequence:CCGGGCAACTTATACCGCAAGATATCTCGAGATATCTTGCGGTATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-522s21c1
Sequence:CCGGGGGCAGTACAGATCAACTTAACTCGAGTTAAGTTGATCTGTACTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-677s21c1
Sequence:CCGGGTGCACTTATTCCTGTAATTCCTCGAGGAATTACAGGAATAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-4967s21c1
Sequence:CCGGAGACTAGGACTGGGTTATAAACTCGAGTTTATAACCCAGTCCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-3321s21c1
Sequence:CCGGTGCAGTTTAGAAGGTTAATATCTCGAGATATTAACCTTCTAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-630s21c1
Sequence:CCGGTGGCAACCATGCAGCTATTAACTCGAGTTAATAGCTGCATGGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-590s21c1
Sequence:CCGGGTCGGCATCATCGAGATAAAGCTCGAGCTTTATCTCGATGATGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-563s21c1
Sequence:CCGGAGCAGTTGCAGAGAAGTAAACCTCGAGGTTTACTTCTCTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173511.1-932s1c1
Sequence:CCGGGAACAATTCTCCTTTGCCCAACTCGAGTTGGGCAAAGGAGAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173511.1-1338s1c1
Sequence:CCGGGAACCAATTGAGGAAGCTGAACTCGAGTTCAGCTTCCTCAATTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173511.1-1860s1c1
Sequence:CCGGCCTCTGTTTCTTGTTCCCTTTCTCGAGAAAGGGAACAAGAAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173511.1-633s1c1
Sequence:CCGGGAAGGATTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173511.1-950s1c1
Sequence:CCGGCAAATATGCAACCTCACCAAACTCGAGTTTGGTGAGGTTGCATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173511.1-1824s1c1
Sequence:CCGGCGTAGCAAACAGGATATTCAACTCGAGTTGAATATCCTGTTTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173511.1-1719s1c1
Sequence:CCGGCCTTGCCAACATGATTCCTAACTCGAGTTAGGAATCATGTTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173511
VALIDATED
FAM117B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 117, member B
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-1010s21c1
Sequence:CCGGTTGTTGATCCCAGAGATAAAGCTCGAGCTTTATCTCTGGGATCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-795s21c1
Sequence:CCGGGCAACTTATACCGCAAGATATCTCGAGATATCTTGCGGTATAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-522s21c1
Sequence:CCGGGGGCAGTACAGATCAACTTAACTCGAGTTAAGTTGATCTGTACTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-677s21c1
Sequence:CCGGGTGCACTTATTCCTGTAATTCCTCGAGGAATTACAGGAATAAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-4967s21c1
Sequence:CCGGAGACTAGGACTGGGTTATAAACTCGAGTTTATAACCCAGTCCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-3321s21c1
Sequence:CCGGTGCAGTTTAGAAGGTTAATATCTCGAGATATTAACCTTCTAAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-630s21c1
Sequence:CCGGTGGCAACCATGCAGCTATTAACTCGAGTTAATAGCTGCATGGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-590s21c1
Sequence:CCGGGTCGGCATCATCGAGATAAAGCTCGAGCTTTATCTCGATGATGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173511.2-563s21c1
Sequence:CCGGAGCAGTTGCAGAGAAGTAAACCTCGAGGTTTACTTCTCTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173511.1-932s1c1
Sequence:CCGGGAACAATTCTCCTTTGCCCAACTCGAGTTGGGCAAAGGAGAATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173511.1-1338s1c1
Sequence:CCGGGAACCAATTGAGGAAGCTGAACTCGAGTTCAGCTTCCTCAATTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173511.1-1860s1c1
Sequence:CCGGCCTCTGTTTCTTGTTCCCTTTCTCGAGAAAGGGAACAAGAAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173511.1-633s1c1
Sequence:CCGGGAAGGATTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173511.1-950s1c1
Sequence:CCGGCAAATATGCAACCTCACCAAACTCGAGTTTGGTGAGGTTGCATATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173511.1-1824s1c1
Sequence:CCGGCGTAGCAAACAGGATATTCAACTCGAGTTGAATATCCTGTTTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173511.1-1719s1c1
Sequence:CCGGCCTTGCCAACATGATTCCTAACTCGAGTTAGGAATCATGTTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003946
VALIDATED
FAM117B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 117, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000191445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-1770s1c1
Sequence:CCGGCCTCTGTTTCTTGTTTCCTTTCTCGAGAAAGGAAACAAGAAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-1038s1c1
Sequence:CCGGCAAGGTGAATTTCATTCCTAACTCGAGTTAGGAATGAAATTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-2423s1c1
Sequence:CCGGGCTAGTTTCTTCTCCAACATTCTCGAGAATGTTGGAGAAGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-577s1c1
Sequence:CCGGGAAGGGCTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003946
VALIDATED
FAM117B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 117, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000191445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-1770s1c1
Sequence:CCGGCCTCTGTTTCTTGTTTCCTTTCTCGAGAAAGGAAACAAGAAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-1038s1c1
Sequence:CCGGCAAGGTGAATTTCATTCCTAACTCGAGTTAGGAATGAAATTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-2423s1c1
Sequence:CCGGGCTAGTTTCTTCTCCAACATTCTCGAGAATGTTGGAGAAGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-577s1c1
Sequence:CCGGGAAGGGCTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003946
VALIDATED
FAM117B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 117, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000191445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-1770s1c1
Sequence:CCGGCCTCTGTTTCTTGTTTCCTTTCTCGAGAAAGGAAACAAGAAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-1038s1c1
Sequence:CCGGCAAGGTGAATTTCATTCCTAACTCGAGTTAGGAATGAAATTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-2423s1c1
Sequence:CCGGGCTAGTTTCTTCTCCAACATTCTCGAGAATGTTGGAGAAGAAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003946.1-577s1c1
Sequence:CCGGGAAGGGCTGAATCAGGAGATTCTCGAGAATCTCCTGATTCAGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks