EMAIL THIS PAGE TO A FRIEND

FAM118A

family with sequence similarity 118, member A

115 Gene Product Result for
Synonyms: C22orf8
UniProtKB ID: Q9NWS6, B3KWG4, Q5TII5, Q96CY3
Gene ID:
Mouse(73225) family with sequence similarity 118, member A
Rat(300120) family with sequence similarity 118, member A
dog(481208) family with sequence similarity 118, member A
cow(505415) family with sequence similarity 118, member A
domestic cat(101094863) family with sequence similarity 118, member A
domestic guinea pig(100722481) family with sequence similarity 118, member A
naked mole-rat(101699316) family with sequence similarity 118, member A
sheep(101119201) family with sequence similarity 118, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104595 Rosetta Predictions human pricing
NM_017911 Rosetta Predictions human pricing
XM_001078208 Rosetta Predictions rat pricing
XM_235547 Rosetta Predictions rat pricing
NM_133750 Rosetta Predictions mouse pricing
NM_177067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323804 predicted 1459
2 SASI_Hs02_00323805 predicted 1369
3 SASI_Hs02_00323806 predicted 1606
4 SASI_Hs02_00323807 predicted 1742
5 SASI_Hs02_00323808 predicted 1439
6 SASI_Hs02_00323809 predicted 1331
7 SASI_Hs02_00323810 predicted 1655
8 SASI_Hs02_00323811 predicted 1371
9 SASI_Hs02_00323812 predicted 1749
10 SASI_Hs02_00323813 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164744 predicted 1127
2 SASI_Hs01_00164745 predicted 1039
3 SASI_Hs01_00164746 predicted 1279
4 SASI_Hs01_00164747 predicted 1411
5 SASI_Hs01_00164748 predicted 1110
6 SASI_Hs01_00164749 predicted 1007
7 SASI_Hs01_00164751 predicted 1328
8 SASI_Hs01_00164752 predicted 1047
9 SASI_Hs01_00164753 predicted 1423
10 SASI_Hs02_00350887 predicted 1170
11 SASI_Hs01_00164750 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359961 predicted 1079
2 SASI_Rn02_00359962 predicted 1589
3 SASI_Rn02_00359963 predicted 986
4 SASI_Rn02_00359964 predicted 1397
5 SASI_Rn02_00359965 predicted 215
6 SASI_Rn02_00359966 predicted 1190
7 SASI_Rn02_00359967 predicted 1280
8 SASI_Rn02_00359968 predicted 1450
9 SASI_Rn02_00359969 predicted 1068
10 SASI_Rn02_00359970 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389459 predicted 1084
2 SASI_Rn02_00389460 predicted 1588
3 SASI_Rn02_00389461 predicted 988
4 SASI_Rn02_00389462 predicted 1394
5 SASI_Rn02_00389463 predicted 211
6 SASI_Rn02_00389464 predicted 1189
7 SASI_Rn02_00389465 predicted 1279
8 SASI_Rn02_00389466 predicted 1444
9 SASI_Rn02_00389467 predicted 1069
10 SASI_Rn02_00389468 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104099 predicted 1258
2 SASI_Mm01_00104100 predicted 1254
3 SASI_Mm01_00104101 predicted 1060
4 SASI_Mm01_00104102 predicted 1107
5 SASI_Mm01_00104103 predicted 1067
6 SASI_Mm01_00104104 predicted 1143
7 SASI_Mm01_00104105 predicted 649
8 SASI_Mm01_00104106 predicted 647
9 SASI_Mm01_00104107 predicted 656
10 SASI_Mm01_00104108 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347029 predicted 852
2 SASI_Mm02_00347030 predicted 859
3 SASI_Mm02_00347031 predicted 410
4 SASI_Mm02_00347032 predicted 942
5 SASI_Mm02_00347033 predicted 862
6 SASI_Mm02_00347034 predicted 442
7 SASI_Mm02_00347035 predicted 609
8 SASI_Mm02_00347036 predicted 670
9 SASI_Mm02_00347037 predicted 743
10 SASI_Mm02_00347038 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133750
VALIDATED
FAM118A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 118, member A
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133750.3-381s1c1
Sequence:CCGGCCATGATCTGATCCGGAAGATCTCGAGATCTTCCGGATCAGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-2016s1c1
Sequence:CCGGCCACGGTTCATATTAAGATTTCTCGAGAAATCTTAATATGAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-665s1c1
Sequence:CCGGGAGTTCTTCATATTCATGGTTCTCGAGAACCATGAATATGAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-910s1c1
Sequence:CCGGGAAGACCATTTCTTTAAGCATCTCGAGATGCTTAAAGAAATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133750.3-858s1c1
Sequence:CCGGCGTGCCAAATAAGGTGGACTTCTCGAGAAGTCCACCTTATTTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-861s1c1
Sequence:CCGGGCCAAATAAGGTGGACTTGGACTCGAGTCCAAGTCCACCTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-665s21c1
Sequence:CCGGGAGTTCTTCATATTCATGGTTCTCGAGAACCATGAATATGAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.4-1148s21c1
Sequence:CCGGGCACCACCTTACTGGGTAATGCTCGAGCATTACCCAGTAAGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133750.3-712s21c1
Sequence:CCGGCTGGATCCATCGGGCTATAAACTCGAGTTTATAGCCCGATGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-638s21c1
Sequence:CCGGAGTGGGCAAGAGGCCATATTACTCGAGTAATATGGCCTCTTGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133750.3-1338s1c1
Sequence:CCGGGAATGACAGAGCTCTACTATGCTCGAGCATAGTAGAGCTCTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133750.3-2016s21c1
Sequence:CCGGCCACGGTTCATATTAAGATTTCTCGAGAAATCTTAATATGAACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-817s21c1
Sequence:CCGGACACTTCGGGACCAGATATTCCTCGAGGAATATCTGGTCCCGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.4-275s21c1
Sequence:CCGGAGGACCTGCTCTTGGTCATTGCTCGAGCAATGACCAAGAGCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133750
VALIDATED
FAM118A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 118, member A
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133750.3-381s1c1
Sequence:CCGGCCATGATCTGATCCGGAAGATCTCGAGATCTTCCGGATCAGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-2016s1c1
Sequence:CCGGCCACGGTTCATATTAAGATTTCTCGAGAAATCTTAATATGAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-665s1c1
Sequence:CCGGGAGTTCTTCATATTCATGGTTCTCGAGAACCATGAATATGAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-910s1c1
Sequence:CCGGGAAGACCATTTCTTTAAGCATCTCGAGATGCTTAAAGAAATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133750.3-858s1c1
Sequence:CCGGCGTGCCAAATAAGGTGGACTTCTCGAGAAGTCCACCTTATTTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-861s1c1
Sequence:CCGGGCCAAATAAGGTGGACTTGGACTCGAGTCCAAGTCCACCTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-665s21c1
Sequence:CCGGGAGTTCTTCATATTCATGGTTCTCGAGAACCATGAATATGAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.4-1148s21c1
Sequence:CCGGGCACCACCTTACTGGGTAATGCTCGAGCATTACCCAGTAAGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133750.3-712s21c1
Sequence:CCGGCTGGATCCATCGGGCTATAAACTCGAGTTTATAGCCCGATGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-638s21c1
Sequence:CCGGAGTGGGCAAGAGGCCATATTACTCGAGTAATATGGCCTCTTGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133750.3-1338s1c1
Sequence:CCGGGAATGACAGAGCTCTACTATGCTCGAGCATAGTAGAGCTCTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133750.3-2016s21c1
Sequence:CCGGCCACGGTTCATATTAAGATTTCTCGAGAAATCTTAATATGAACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-817s21c1
Sequence:CCGGACACTTCGGGACCAGATATTCCTCGAGGAATATCTGGTCCCGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.4-275s21c1
Sequence:CCGGAGGACCTGCTCTTGGTCATTGCTCGAGCAATGACCAAGAGCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133750
VALIDATED
FAM118A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 118, member A
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133750.3-381s1c1
Sequence:CCGGCCATGATCTGATCCGGAAGATCTCGAGATCTTCCGGATCAGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-2016s1c1
Sequence:CCGGCCACGGTTCATATTAAGATTTCTCGAGAAATCTTAATATGAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-665s1c1
Sequence:CCGGGAGTTCTTCATATTCATGGTTCTCGAGAACCATGAATATGAAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-910s1c1
Sequence:CCGGGAAGACCATTTCTTTAAGCATCTCGAGATGCTTAAAGAAATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133750.3-858s1c1
Sequence:CCGGCGTGCCAAATAAGGTGGACTTCTCGAGAAGTCCACCTTATTTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133750.3-861s1c1
Sequence:CCGGGCCAAATAAGGTGGACTTGGACTCGAGTCCAAGTCCACCTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-665s21c1
Sequence:CCGGGAGTTCTTCATATTCATGGTTCTCGAGAACCATGAATATGAAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.4-1148s21c1
Sequence:CCGGGCACCACCTTACTGGGTAATGCTCGAGCATTACCCAGTAAGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133750.3-712s21c1
Sequence:CCGGCTGGATCCATCGGGCTATAAACTCGAGTTTATAGCCCGATGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-638s21c1
Sequence:CCGGAGTGGGCAAGAGGCCATATTACTCGAGTAATATGGCCTCTTGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133750.3-1338s1c1
Sequence:CCGGGAATGACAGAGCTCTACTATGCTCGAGCATAGTAGAGCTCTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133750.3-2016s21c1
Sequence:CCGGCCACGGTTCATATTAAGATTTCTCGAGAAATCTTAATATGAACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.3-817s21c1
Sequence:CCGGACACTTCGGGACCAGATATTCCTCGAGGAATATCTGGTCCCGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133750.4-275s21c1
Sequence:CCGGAGGACCTGCTCTTGGTCATTGCTCGAGCAATGACCAAGAGCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017911
FAM118A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 118, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017911.1-919s1c1
Sequence:CCGGCCAGAACTTATACCGCACCAACTCGAGTTGGTGCGGTATAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017911.1-1536s1c1
Sequence:CCGGGACACATTTCAGGTGGACTTTCTCGAGAAAGTCCACCTGAAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017911.1-1295s1c1
Sequence:CCGGCGCACACAATCAGATACTGATCTCGAGATCAGTATCTGATTGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1435s1c1
Sequence:CCGGCGAAACCGTCACATACACCAACTCGAGTTGGTGTATGTGACGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1393s1c1
Sequence:CCGGCGAAGAGGAATGTATGGAGAACTCGAGTTCTCCATACATTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1386s1c1
Sequence:CCGGGCCCAAACGAAGAGGAATGTACTCGAGTACATTCCTCTTCGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017911.2-997s21c1
Sequence:CCGGGACCCTTCGTGATCAGATATTCTCGAGAATATCTGATCACGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017911.2-1031s21c1
Sequence:CCGGCTTTACTCCGTGCCGAATAAGCTCGAGCTTATTCGGCACGGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017911
FAM118A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 118, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017911.1-919s1c1
Sequence:CCGGCCAGAACTTATACCGCACCAACTCGAGTTGGTGCGGTATAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017911.1-1536s1c1
Sequence:CCGGGACACATTTCAGGTGGACTTTCTCGAGAAAGTCCACCTGAAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017911.1-1295s1c1
Sequence:CCGGCGCACACAATCAGATACTGATCTCGAGATCAGTATCTGATTGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1435s1c1
Sequence:CCGGCGAAACCGTCACATACACCAACTCGAGTTGGTGTATGTGACGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1393s1c1
Sequence:CCGGCGAAGAGGAATGTATGGAGAACTCGAGTTCTCCATACATTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1386s1c1
Sequence:CCGGGCCCAAACGAAGAGGAATGTACTCGAGTACATTCCTCTTCGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017911.2-997s21c1
Sequence:CCGGGACCCTTCGTGATCAGATATTCTCGAGAATATCTGATCACGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017911.2-1031s21c1
Sequence:CCGGCTTTACTCCGTGCCGAATAAGCTCGAGCTTATTCGGCACGGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017911
FAM118A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 118, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017911.1-919s1c1
Sequence:CCGGCCAGAACTTATACCGCACCAACTCGAGTTGGTGCGGTATAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017911.1-1536s1c1
Sequence:CCGGGACACATTTCAGGTGGACTTTCTCGAGAAAGTCCACCTGAAATGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017911.1-1295s1c1
Sequence:CCGGCGCACACAATCAGATACTGATCTCGAGATCAGTATCTGATTGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1435s1c1
Sequence:CCGGCGAAACCGTCACATACACCAACTCGAGTTGGTGTATGTGACGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1393s1c1
Sequence:CCGGCGAAGAGGAATGTATGGAGAACTCGAGTTCTCCATACATTCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017911.1-1386s1c1
Sequence:CCGGGCCCAAACGAAGAGGAATGTACTCGAGTACATTCCTCTTCGTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017911.2-997s21c1
Sequence:CCGGGACCCTTCGTGATCAGATATTCTCGAGAATATCTGATCACGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017911.2-1031s21c1
Sequence:CCGGCTTTACTCCGTGCCGAATAAGCTCGAGCTTATTCGGCACGGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks