EMAIL THIS PAGE TO A FRIEND

FAM118B

family with sequence similarity 118, member B

117 Gene Product Result for
UniProtKB ID: Q9BPY3, Q9H7B0
Gene ID:
Mouse(109229) family with sequence similarity 118, member B
Rat(315549) family with sequence similarity 118, member B
sheep(101113968) family with sequence similarity 118, member B
naked mole-rat(101712458) family with sequence similarity 118, member B
domestic guinea pig(100717663) family with sequence similarity 118, member B
chicken(419714) family with sequence similarity 118, member B
cow(540626) family with sequence similarity 118, member B
domestic cat(101088184) family with sequence similarity 118, member B
dog(489294) family with sequence similarity 118, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024556 Rosetta Predictions human pricing
NM_001025283 Rosetta Predictions rat pricing
NM_175411 Rosetta Predictions mouse pricing
NM_194257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035766 predicted 1215
2 SASI_Hs01_00035767 predicted 315
3 SASI_Hs01_00035768 predicted 1326
4 SASI_Hs01_00035769 predicted 993
5 SASI_Hs01_00035770 predicted 1169
6 SASI_Hs01_00035771 predicted 295
7 SASI_Hs01_00035772 predicted 1323
8 SASI_Hs01_00035773 predicted 830
9 SASI_Hs01_00035774 predicted 1304
10 SASI_Hs01_00035775 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104125 predicted 359
2 SASI_Rn01_00104126 predicted 1036
3 SASI_Rn01_00104127 predicted 713
4 SASI_Rn01_00104128 predicted 802
5 SASI_Rn01_00104129 predicted 826
6 SASI_Rn01_00104131 predicted 706
7 SASI_Rn01_00104132 predicted 1002
8 SASI_Rn01_00104133 predicted 668
9 SASI_Rn01_00104134 predicted 236
10 SASI_Rn02_00203114 predicted 518
11 SASI_Rn01_00104130 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184012 predicted 755
2 SASI_Mm01_00184013 predicted 820
3 SASI_Mm02_00346282 predicted 980
4 SASI_Mm02_00346283 predicted 1049
5 SASI_Mm01_00184015 predicted 615
6 SASI_Mm01_00184017 predicted 876
7 SASI_Mm01_00184018 predicted 802
8 SASI_Mm02_00346284 predicted 1149
9 SASI_Mm02_00346285 predicted 933
10 SASI_Mm02_00346286 predicted 1111
11 SASI_Mm01_00184014 predicted 827
12 SASI_Mm01_00184016 predicted 759
13 SASI_Mm01_00184019 predicted 629
14 SASI_Mm01_00184020 predicted 786
15 SASI_Mm01_00184021 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350589 predicted 866
2 SASI_Mm02_00350590 predicted 388
3 SASI_Mm02_00350591 predicted 1080
4 SASI_Mm02_00350592 predicted 417
5 SASI_Mm01_00117149 predicted 1026
6 SASI_Mm02_00350593 predicted 229
7 SASI_Mm02_00350594 predicted 737
8 SASI_Mm02_00350595 predicted 702
9 SASI_Mm01_00117152 predicted 977
10 SASI_Mm02_00350596 predicted 263
11 SASI_Mm01_00117143 predicted 976
12 SASI_Mm01_00117144 predicted 1045
13 SASI_Mm01_00117145 predicted 1048
14 SASI_Mm01_00117146 predicted 840
15 SASI_Mm01_00117147 predicted 979
16 SASI_Mm01_00117148 predicted 1092
17 SASI_Mm01_00117150 predicted 843
18 SASI_Mm01_00117151 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175411
VALIDATED
FAM118B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 118, member B
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-537s21c1
Sequence:CCGGGAGATTCAGAAACTCTATGAACTCGAGTTCATAGAGTTTCTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175411.4-828s1c1
Sequence:CCGGGCAAGAGAAGGTCAGCTAAATCTCGAGATTTAGCTGACCTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175411.4-278s1c1
Sequence:CCGGCTTACTGGATGCTGCTATTGACTCGAGTCAATAGCAGCATCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175411.4-931s21c1
Sequence:CCGGGCCTTCCTGTGGATGTGTTAACTCGAGTTAACACATCCACAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-633s21c1
Sequence:CCGGGTCAAGCATAAATCTGACCTACTCGAGTAGGTCAGATTTATGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-521s21c1
Sequence:CCGGCACTGAAGTTATGAGAGAGATCTCGAGATCTCTCTCATAACTTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-187s1c1
Sequence:CCGGCGAGAACTTGTGCTGGTGATTCTCGAGAATCACCAGCACAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-932s1c1
Sequence:CCGGGCCTTCCTGTGGATGTGTTAACTCGAGTTAACACATCCACAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-522s1c1
Sequence:CCGGCACTGAAGTTATGAGAGAGATCTCGAGATCTCTCTCATAACTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175411.2-538s1c1
Sequence:CCGGGAGATTCAGAAACTCTATGAACTCGAGTTCATAGAGTTTCTGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175411.2-634s1c1
Sequence:CCGGGTCAAGCATAAATCTGACCTACTCGAGTAGGTCAGATTTATGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175411.2-1392s1c1
Sequence:CCGGCCAGAACTCTGGCTCTACTTTCTCGAGAAAGTAGAGCCAGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197636    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175411.2-1303s1c1
Sequence:CCGGCATGACTTGAAGCTCTAGTTTCTCGAGAAACTAGAGCTTCAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175411
VALIDATED
FAM118B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 118, member B
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-537s21c1
Sequence:CCGGGAGATTCAGAAACTCTATGAACTCGAGTTCATAGAGTTTCTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175411.4-828s1c1
Sequence:CCGGGCAAGAGAAGGTCAGCTAAATCTCGAGATTTAGCTGACCTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175411.4-278s1c1
Sequence:CCGGCTTACTGGATGCTGCTATTGACTCGAGTCAATAGCAGCATCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175411.4-931s21c1
Sequence:CCGGGCCTTCCTGTGGATGTGTTAACTCGAGTTAACACATCCACAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-633s21c1
Sequence:CCGGGTCAAGCATAAATCTGACCTACTCGAGTAGGTCAGATTTATGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-521s21c1
Sequence:CCGGCACTGAAGTTATGAGAGAGATCTCGAGATCTCTCTCATAACTTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-187s1c1
Sequence:CCGGCGAGAACTTGTGCTGGTGATTCTCGAGAATCACCAGCACAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-932s1c1
Sequence:CCGGGCCTTCCTGTGGATGTGTTAACTCGAGTTAACACATCCACAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-522s1c1
Sequence:CCGGCACTGAAGTTATGAGAGAGATCTCGAGATCTCTCTCATAACTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175411.2-538s1c1
Sequence:CCGGGAGATTCAGAAACTCTATGAACTCGAGTTCATAGAGTTTCTGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175411.2-634s1c1
Sequence:CCGGGTCAAGCATAAATCTGACCTACTCGAGTAGGTCAGATTTATGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175411.2-1392s1c1
Sequence:CCGGCCAGAACTCTGGCTCTACTTTCTCGAGAAAGTAGAGCCAGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197636    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175411.2-1303s1c1
Sequence:CCGGCATGACTTGAAGCTCTAGTTTCTCGAGAAACTAGAGCTTCAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175411
VALIDATED
FAM118B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 118, member B
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-537s21c1
Sequence:CCGGGAGATTCAGAAACTCTATGAACTCGAGTTCATAGAGTTTCTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175411.4-828s1c1
Sequence:CCGGGCAAGAGAAGGTCAGCTAAATCTCGAGATTTAGCTGACCTTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175411.4-278s1c1
Sequence:CCGGCTTACTGGATGCTGCTATTGACTCGAGTCAATAGCAGCATCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175411.4-931s21c1
Sequence:CCGGGCCTTCCTGTGGATGTGTTAACTCGAGTTAACACATCCACAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-633s21c1
Sequence:CCGGGTCAAGCATAAATCTGACCTACTCGAGTAGGTCAGATTTATGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175411.4-521s21c1
Sequence:CCGGCACTGAAGTTATGAGAGAGATCTCGAGATCTCTCTCATAACTTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-187s1c1
Sequence:CCGGCGAGAACTTGTGCTGGTGATTCTCGAGAATCACCAGCACAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-932s1c1
Sequence:CCGGGCCTTCCTGTGGATGTGTTAACTCGAGTTAACACATCCACAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175411.2-522s1c1
Sequence:CCGGCACTGAAGTTATGAGAGAGATCTCGAGATCTCTCTCATAACTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175411.2-538s1c1
Sequence:CCGGGAGATTCAGAAACTCTATGAACTCGAGTTCATAGAGTTTCTGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175411.2-634s1c1
Sequence:CCGGGTCAAGCATAAATCTGACCTACTCGAGTAGGTCAGATTTATGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175411.2-1392s1c1
Sequence:CCGGCCAGAACTCTGGCTCTACTTTCTCGAGAAAGTAGAGCCAGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197636    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175411.2-1303s1c1
Sequence:CCGGCATGACTTGAAGCTCTAGTTTCTCGAGAAACTAGAGCTTCAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024556
VALIDATED
FAM118B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 118, member B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-631s1c1
Sequence:CCGGCCTTGACCTTACTGATGAGAACTCGAGTTCTCATCAGTAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024556.1-694s1c1
Sequence:CCGGGTTGCATATTCACGGAGTCTACTCGAGTAGACTCCGTGAATATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-209s1c1
Sequence:CCGGCGAGAACTTGTGCTAGTGATTCTCGAGAATCACTAGCACAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-432s1c1
Sequence:CCGGCCAGTAATGTTCGATCCACATCTCGAGATGTGGATCGAACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-1006s1c1
Sequence:CCGGCTATGCCGATCTTCCAGAATACTCGAGTATTCTGGAAGATCGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024556.1-1119s1c1
Sequence:CCGGGTGAAATAAGAGGCTGTAGTACTCGAGTACTACAGCCTCTTATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024556
VALIDATED
FAM118B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 118, member B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-631s1c1
Sequence:CCGGCCTTGACCTTACTGATGAGAACTCGAGTTCTCATCAGTAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024556.1-694s1c1
Sequence:CCGGGTTGCATATTCACGGAGTCTACTCGAGTAGACTCCGTGAATATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-209s1c1
Sequence:CCGGCGAGAACTTGTGCTAGTGATTCTCGAGAATCACTAGCACAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-432s1c1
Sequence:CCGGCCAGTAATGTTCGATCCACATCTCGAGATGTGGATCGAACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-1006s1c1
Sequence:CCGGCTATGCCGATCTTCCAGAATACTCGAGTATTCTGGAAGATCGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024556.1-1119s1c1
Sequence:CCGGGTGAAATAAGAGGCTGTAGTACTCGAGTACTACAGCCTCTTATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024556
VALIDATED
FAM118B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 118, member B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-631s1c1
Sequence:CCGGCCTTGACCTTACTGATGAGAACTCGAGTTCTCATCAGTAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024556.1-694s1c1
Sequence:CCGGGTTGCATATTCACGGAGTCTACTCGAGTAGACTCCGTGAATATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-209s1c1
Sequence:CCGGCGAGAACTTGTGCTAGTGATTCTCGAGAATCACTAGCACAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-432s1c1
Sequence:CCGGCCAGTAATGTTCGATCCACATCTCGAGATGTGGATCGAACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024556.1-1006s1c1
Sequence:CCGGCTATGCCGATCTTCCAGAATACTCGAGTATTCTGGAAGATCGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024556.1-1119s1c1
Sequence:CCGGGTGAAATAAGAGGCTGTAGTACTCGAGTACTACAGCCTCTTATTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks