EMAIL THIS PAGE TO A FRIEND

FAM120AOS

family with sequence similarity 120A opposite strand

39 Gene Product Result for
Synonyms: C9orf10OS
UniProtKB ID: Q5T036, A6NN20
Gene ID:
Mouse(68128) family with sequence similarity 120A opposite strand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198841 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198841 Rosetta Predictions human pricing
XM_001473676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043879 predicted 910
2 SASI_Hs01_00043881 predicted 1474
3 SASI_Hs01_00043880 predicted 1576
4 SASI_Hs01_00043883 predicted 1613
5 SASI_Hs01_00043884 predicted 1572
6 SASI_Hs01_00043885 predicted 1516
7 SASI_Hs01_00043886 predicted 1632
8 SASI_Hs01_00043887 predicted 1506
9 SASI_Hs01_00043888 predicted 1661
10 SASI_Hs02_00372349 predicted 1433
11 SASI_Hs01_00043882 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369876 predicted 557
2 SASI_Mm02_00369877 predicted 557
3 SASI_Mm02_00369878 predicted 522
4 SASI_Mm02_00369879 predicted 552
5 SASI_Mm02_00369880 predicted 523
6 SASI_Mm02_00369881 predicted 506
7 SASI_Mm02_00369882 predicted 541
8 SASI_Mm02_00369883 predicted 538
9 SASI_Mm02_00369884 predicted 626
10 SASI_Mm02_00369885 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198841
VALIDATED
FAM120AOS MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120A opposite strand
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198841.2-912s21c1
Sequence:CCGGATGACACTGTCGCCTCCGAATCTCGAGATTCGGAGGCGACAGTGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198841.2-2009s21c1
Sequence:CCGGTAGACAGACATATAGACAAATCTCGAGATTTGTCTATATGTCTGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198841.2-2109s21c1
Sequence:CCGGCAGATCATATTGCCCTTTATACTCGAGTATAAAGGGCAATATGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1386s1c1
Sequence:CCGGCGTTGAAGAAGACGAAGAGCTCTCGAGAGCTCTTCGTCTTCTTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1674s1c1
Sequence:CCGGGCAGAGGCATTGAAAGGACAACTCGAGTTGTCCTTTCAATGCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1573s1c1
Sequence:CCGGCAGAAGCTGTTCTGTCAATAACTCGAGTTATTGACAGAACAGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1626s1c1
Sequence:CCGGCACTAAGATCATTCTTGAGTCCTCGAGGACTCAAGAATGATCTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1588s1c1
Sequence:CCGGCAATAACAAAGTCTCAGAGAACTCGAGTTCTCTGAGACTTTGTTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1567s1c1
Sequence:CCGGGATTTCCAGAAGCTGTTCTGTCTCGAGACAGAACAGCTTCTGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1393s1c1
Sequence:CCGGGAAGACGAAGAGCTCGATGTTCTCGAGAACATCGAGCTCTTCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198841
VALIDATED
FAM120AOS MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120A opposite strand
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198841.2-912s21c1
Sequence:CCGGATGACACTGTCGCCTCCGAATCTCGAGATTCGGAGGCGACAGTGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198841.2-2009s21c1
Sequence:CCGGTAGACAGACATATAGACAAATCTCGAGATTTGTCTATATGTCTGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198841.2-2109s21c1
Sequence:CCGGCAGATCATATTGCCCTTTATACTCGAGTATAAAGGGCAATATGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1386s1c1
Sequence:CCGGCGTTGAAGAAGACGAAGAGCTCTCGAGAGCTCTTCGTCTTCTTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1674s1c1
Sequence:CCGGGCAGAGGCATTGAAAGGACAACTCGAGTTGTCCTTTCAATGCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1573s1c1
Sequence:CCGGCAGAAGCTGTTCTGTCAATAACTCGAGTTATTGACAGAACAGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1626s1c1
Sequence:CCGGCACTAAGATCATTCTTGAGTCCTCGAGGACTCAAGAATGATCTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1588s1c1
Sequence:CCGGCAATAACAAAGTCTCAGAGAACTCGAGTTCTCTGAGACTTTGTTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1567s1c1
Sequence:CCGGGATTTCCAGAAGCTGTTCTGTCTCGAGACAGAACAGCTTCTGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1393s1c1
Sequence:CCGGGAAGACGAAGAGCTCGATGTTCTCGAGAACATCGAGCTCTTCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198841
VALIDATED
FAM120AOS MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120A opposite strand
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198841.2-912s21c1
Sequence:CCGGATGACACTGTCGCCTCCGAATCTCGAGATTCGGAGGCGACAGTGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198841.2-2009s21c1
Sequence:CCGGTAGACAGACATATAGACAAATCTCGAGATTTGTCTATATGTCTGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198841.2-2109s21c1
Sequence:CCGGCAGATCATATTGCCCTTTATACTCGAGTATAAAGGGCAATATGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1386s1c1
Sequence:CCGGCGTTGAAGAAGACGAAGAGCTCTCGAGAGCTCTTCGTCTTCTTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1674s1c1
Sequence:CCGGGCAGAGGCATTGAAAGGACAACTCGAGTTGTCCTTTCAATGCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1573s1c1
Sequence:CCGGCAGAAGCTGTTCTGTCAATAACTCGAGTTATTGACAGAACAGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198841.1-1626s1c1
Sequence:CCGGCACTAAGATCATTCTTGAGTCCTCGAGGACTCAAGAATGATCTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1588s1c1
Sequence:CCGGCAATAACAAAGTCTCAGAGAACTCGAGTTCTCTGAGACTTTGTTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1567s1c1
Sequence:CCGGGATTTCCAGAAGCTGTTCTGTCTCGAGACAGAACAGCTTCTGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198841.1-1393s1c1
Sequence:CCGGGAAGACGAAGAGCTCGATGTTCTCGAGAACATCGAGCTCTTCGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)