EMAIL THIS PAGE TO A FRIEND

FAM120B

family with sequence similarity 120B

47 Gene Product Result for
Synonyms: CCPG KIAA1838 PGCC1 dJ894D12.1
UniProtKB ID: Q96EK7, Q86V68, Q96JI9
Gene ID:
Mouse(67544) family with sequence similarity 120, member B
Rat(308218) family with sequence similarity 120B
sheep(101115971) family with sequence similarity 120B
naked mole-rat(101700172) family with sequence similarity 120B
domestic guinea pig(100713545) family with sequence similarity 120B
Zebrafish(445206) family with sequence similarity 120B
chicken(421552) family with sequence similarity 120B
cow(524306) family with sequence similarity 120B
domestic cat(101083940) family with sequence similarity 120B
dog(612641) family with sequence similarity 120B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032448 Rosetta Predictions human pricing
NM_001107466 Rosetta Predictions rat pricing
NM_024203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080177 predicted 1627
2 SASI_Hs01_00080178 predicted 793
3 SASI_Hs01_00080179 predicted 1722
4 SASI_Hs01_00080180 predicted 2559
5 SASI_Hs01_00080181 predicted 933
6 SASI_Hs01_00080182 predicted 1084
7 SASI_Hs01_00080183 predicted 253
8 SASI_Hs01_00080184 predicted 1257
9 SASI_Hs01_00080185 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229105 predicted 1149
2 SASI_Rn02_00229106 predicted 2350
3 SASI_Rn02_00229107 predicted 1758
4 SASI_Rn02_00229108 predicted 1600
5 SASI_Rn02_00229109 predicted 2237
6 SASI_Rn02_00229110 predicted 524
7 SASI_Rn02_00229111 predicted 2517
8 SASI_Rn02_00229112 predicted 1406
9 SASI_Rn02_00229113 predicted 1724
10 SASI_Rn02_00229114 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327557 predicted 2709
2 SASI_Mm01_00085931 predicted 2718
3 SASI_Mm01_00085933 predicted 2415
4 SASI_Mm01_00085934 predicted 1755
5 SASI_Mm02_00327558 predicted 524
6 SASI_Mm01_00085936 predicted 1403
7 SASI_Mm01_00085937 predicted 1292
8 SASI_Mm01_00085938 predicted 1605
9 SASI_Mm01_00085939 predicted 1567
10 SASI_Mm01_00085940 predicted 1347
11 SASI_Mm01_00085932 predicted 942
12 SASI_Mm01_00085935 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032448
FAM120B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032448.1-2242s1c1
Sequence:CCGGGCTGTCGAAAGCCCATTTCAACTCGAGTTGAAATGGGCTTTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2849s1c1
Sequence:CCGGCCAGAAAGAGTATGGAGAGAACTCGAGTTCTCTCCATACTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2960s1c1
Sequence:CCGGCTTGCATGAAGAAGGAACGATCTCGAGATCGTTCCTTCTTCATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2959s1c1
Sequence:CCGGGCTTGCATGAAGAAGGAACGACTCGAGTCGTTCCTTCTTCATGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032448.1-1963s1c1
Sequence:CCGGGCCTTCATTTACCGTCCCATTCTCGAGAATGGGACGGTAAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-902s21c1
Sequence:CCGGTAGCTGTGTCAGACCATATATCTCGAGATATATGGTCTGACACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032448.1-3082s21c1
Sequence:CCGGACATCTTCATGTGTTTCATTCCTCGAGGAATGAAACACATGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-1193s21c1
Sequence:CCGGGGCGAGAAGTTCCCGTGTATACTCGAGTATACACGGGAACTTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-2317s21c1
Sequence:CCGGGAGGATTTGCATGCGTTTATTCTCGAGAATAAACGCATGCAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-1671s21c1
Sequence:CCGGCATGTGTACACACGCTGAAATCTCGAGATTTCAGCGTGTGTACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032448
FAM120B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032448.1-2242s1c1
Sequence:CCGGGCTGTCGAAAGCCCATTTCAACTCGAGTTGAAATGGGCTTTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2849s1c1
Sequence:CCGGCCAGAAAGAGTATGGAGAGAACTCGAGTTCTCTCCATACTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2960s1c1
Sequence:CCGGCTTGCATGAAGAAGGAACGATCTCGAGATCGTTCCTTCTTCATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2959s1c1
Sequence:CCGGGCTTGCATGAAGAAGGAACGACTCGAGTCGTTCCTTCTTCATGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032448.1-1963s1c1
Sequence:CCGGGCCTTCATTTACCGTCCCATTCTCGAGAATGGGACGGTAAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-902s21c1
Sequence:CCGGTAGCTGTGTCAGACCATATATCTCGAGATATATGGTCTGACACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032448.1-3082s21c1
Sequence:CCGGACATCTTCATGTGTTTCATTCCTCGAGGAATGAAACACATGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-1193s21c1
Sequence:CCGGGGCGAGAAGTTCCCGTGTATACTCGAGTATACACGGGAACTTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-2317s21c1
Sequence:CCGGGAGGATTTGCATGCGTTTATTCTCGAGAATAAACGCATGCAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-1671s21c1
Sequence:CCGGCATGTGTACACACGCTGAAATCTCGAGATTTCAGCGTGTGTACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032448
FAM120B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032448.1-2242s1c1
Sequence:CCGGGCTGTCGAAAGCCCATTTCAACTCGAGTTGAAATGGGCTTTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2849s1c1
Sequence:CCGGCCAGAAAGAGTATGGAGAGAACTCGAGTTCTCTCCATACTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2960s1c1
Sequence:CCGGCTTGCATGAAGAAGGAACGATCTCGAGATCGTTCCTTCTTCATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032448.1-2959s1c1
Sequence:CCGGGCTTGCATGAAGAAGGAACGACTCGAGTCGTTCCTTCTTCATGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032448.1-1963s1c1
Sequence:CCGGGCCTTCATTTACCGTCCCATTCTCGAGAATGGGACGGTAAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-902s21c1
Sequence:CCGGTAGCTGTGTCAGACCATATATCTCGAGATATATGGTCTGACACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032448.1-3082s21c1
Sequence:CCGGACATCTTCATGTGTTTCATTCCTCGAGGAATGAAACACATGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-1193s21c1
Sequence:CCGGGGCGAGAAGTTCCCGTGTATACTCGAGTATACACGGGAACTTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-2317s21c1
Sequence:CCGGGAGGATTTGCATGCGTTTATTCTCGAGAATAAACGCATGCAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032448.1-1671s21c1
Sequence:CCGGCATGTGTACACACGCTGAAATCTCGAGATTTCAGCGTGTGTACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024203
VALIDATED
FAM120B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024203.2-542s1c1
Sequence:CCGGCGGCATCAAGTTGATATTCTTCTCGAGAAGAATATCAACTTGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1679s21c1
Sequence:CCGGTTCCGAGTCTGAGATCTTAAACTCGAGTTTAAGATCTCAGACTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024203.3-4362s1c1
Sequence:CCGGGTACGTCAGTCACAAGTTTAACTCGAGTTAAACTTGTGACTGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024203.3-3734s21c1
Sequence:CCGGGCATAGTGGGTTAAGCTTAAACTCGAGTTTAAGCTTAACCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1124s21c1
Sequence:CCGGCCTAGCTGTCTCAGACTATATCTCGAGATATAGTCTGAGACAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1732s21c1
Sequence:CCGGGCTACCTAGTGTACAACATTCCTCGAGGAATGTTGTACACTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1520s21c1
Sequence:CCGGGCCAGAAGTTTCCCAATATACCTCGAGGTATATTGGGAAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024203
VALIDATED
FAM120B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024203.2-542s1c1
Sequence:CCGGCGGCATCAAGTTGATATTCTTCTCGAGAAGAATATCAACTTGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1679s21c1
Sequence:CCGGTTCCGAGTCTGAGATCTTAAACTCGAGTTTAAGATCTCAGACTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024203.3-4362s1c1
Sequence:CCGGGTACGTCAGTCACAAGTTTAACTCGAGTTAAACTTGTGACTGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024203.3-3734s21c1
Sequence:CCGGGCATAGTGGGTTAAGCTTAAACTCGAGTTTAAGCTTAACCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1124s21c1
Sequence:CCGGCCTAGCTGTCTCAGACTATATCTCGAGATATAGTCTGAGACAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1732s21c1
Sequence:CCGGGCTACCTAGTGTACAACATTCCTCGAGGAATGTTGTACACTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1520s21c1
Sequence:CCGGGCCAGAAGTTTCCCAATATACCTCGAGGTATATTGGGAAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024203
VALIDATED
FAM120B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024203.2-542s1c1
Sequence:CCGGCGGCATCAAGTTGATATTCTTCTCGAGAAGAATATCAACTTGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1679s21c1
Sequence:CCGGTTCCGAGTCTGAGATCTTAAACTCGAGTTTAAGATCTCAGACTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024203.3-4362s1c1
Sequence:CCGGGTACGTCAGTCACAAGTTTAACTCGAGTTAAACTTGTGACTGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024203.3-3734s21c1
Sequence:CCGGGCATAGTGGGTTAAGCTTAAACTCGAGTTTAAGCTTAACCCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1124s21c1
Sequence:CCGGCCTAGCTGTCTCAGACTATATCTCGAGATATAGTCTGAGACAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1732s21c1
Sequence:CCGGGCTACCTAGTGTACAACATTCCTCGAGGAATGTTGTACACTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024203.3-1520s21c1
Sequence:CCGGGCCAGAAGTTTCCCAATATACCTCGAGGTATATTGGGAAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks