EMAIL THIS PAGE TO A FRIEND

FAM120C

family with sequence similarity 120C

117 Gene Product Result for
Synonyms: CXorf17 ORF34
UniProtKB ID: Q9NX05, B2RMT7
Gene ID:
Human(54954) Summary: This gene encodes a potential transmembrane protein and lies in a region where mutations and deletions have been associated with intellectual disability and autism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(207375) family with sequence similarity 120, member C
Rat(317423) family with sequence similarity 120C
Zebrafish(557842) family with sequence similarity 120C
cow(536163) family with sequence similarity 120C
domestic cat(101092747) family with sequence similarity 120C
dog(100688533) family with sequence similarity 120C
domestic guinea pig(100721201) family with sequence similarity 120C
naked mole-rat(101717559) family with sequence similarity 120C
sheep(101117820) family with sequence similarity 120C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017848 Rosetta Predictions human pricing
XM_001068090 Rosetta Predictions rat pricing
XM_228876 Rosetta Predictions rat pricing
NM_198105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119688 predicted 3344
2 SASI_Hs01_00119690 predicted 885
3 SASI_Hs01_00119691 predicted 1555
4 SASI_Hs01_00119692 predicted 2838
5 SASI_Hs01_00119693 predicted 1935
6 SASI_Hs01_00119694 predicted 1301
7 SASI_Hs01_00119695 predicted 930
8 SASI_Hs01_00119696 predicted 3182
9 SASI_Hs01_00119697 predicted 2051
10 SASI_Hs02_00350744 predicted 3271
11 SASI_Hs01_00119689 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323419 predicted 1512
2 SASI_Rn02_00323420 predicted 1124
3 SASI_Rn02_00323421 predicted 2157
4 SASI_Rn02_00323422 predicted 1890
5 SASI_Rn02_00323423 predicted 1339
6 SASI_Rn02_00323424 predicted 887
7 SASI_Rn02_00323425 predicted 2794
8 SASI_Rn02_00323426 predicted 3213
9 SASI_Rn02_00323427 predicted 3200
10 SASI_Rn02_00323428 predicted 2520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385605 predicted 1527
2 SASI_Rn02_00385606 predicted 1133
3 SASI_Rn02_00385607 predicted 2172
4 SASI_Rn02_00385608 predicted 1901
5 SASI_Rn02_00385609 predicted 1344
6 SASI_Rn02_00385610 predicted 896
7 SASI_Rn02_00385611 predicted 2801
8 SASI_Rn02_00385612 predicted 3223
9 SASI_Rn02_00385613 predicted 3212
10 SASI_Rn02_00385614 predicted 2534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064928 predicted 1481
2 SASI_Mm02_00350830 predicted 1221
3 SASI_Mm01_00064929 predicted 1976
4 SASI_Mm01_00064931 predicted 2130
5 SASI_Mm01_00064932 predicted 1098
6 SASI_Mm01_00064933 predicted 1311
7 SASI_Mm02_00350831 predicted 1091
8 SASI_Mm01_00064934 predicted 939
9 SASI_Mm02_00350832 predicted 1235
10 SASI_Mm01_00064935 predicted 1260
11 SASI_Mm01_00064930 predicted 1073
12 SASI_Mm01_00064936 predicted 2953
13 SASI_Mm01_00064937 predicted 3072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017848
VALIDATED
FAM120C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017848.4-2329s21c1
Sequence:CCGGACACGCCCAGTATGCTCAATCCTCGAGGATTGAGCATACTGGGCGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017848.4-1934s21c1
Sequence:CCGGGGGTCTTATGTACCCATATATCTCGAGATATATGGGTACATAAGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017848.3-868s1c1
Sequence:CCGGCCCTCTTACTACAGTTCCCATCTCGAGATGGGAACTGTAGTAAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-845s1c1
Sequence:CCGGCCGAGTATGCTCTCTACAATACTCGAGTATTGTAGAGAGCATACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-2136s1c1
Sequence:CCGGCCTTAAAGAGTGGTCTGCCTACTCGAGTAGGCAGACCACTCTTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017848.3-1242s1c1
Sequence:CCGGGCGATTCAAGAAAGCAGTTGACTCGAGTCAACTGCTTTCTTGAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-1357s1c1
Sequence:CCGGCGAAATCAAGTGGGCACCATTCTCGAGAATGGTGCCCACTTGATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017848
VALIDATED
FAM120C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017848.4-2329s21c1
Sequence:CCGGACACGCCCAGTATGCTCAATCCTCGAGGATTGAGCATACTGGGCGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017848.4-1934s21c1
Sequence:CCGGGGGTCTTATGTACCCATATATCTCGAGATATATGGGTACATAAGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017848.3-868s1c1
Sequence:CCGGCCCTCTTACTACAGTTCCCATCTCGAGATGGGAACTGTAGTAAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-845s1c1
Sequence:CCGGCCGAGTATGCTCTCTACAATACTCGAGTATTGTAGAGAGCATACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-2136s1c1
Sequence:CCGGCCTTAAAGAGTGGTCTGCCTACTCGAGTAGGCAGACCACTCTTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017848.3-1242s1c1
Sequence:CCGGGCGATTCAAGAAAGCAGTTGACTCGAGTCAACTGCTTTCTTGAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-1357s1c1
Sequence:CCGGCGAAATCAAGTGGGCACCATTCTCGAGAATGGTGCCCACTTGATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017848
VALIDATED
FAM120C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017848.4-2329s21c1
Sequence:CCGGACACGCCCAGTATGCTCAATCCTCGAGGATTGAGCATACTGGGCGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017848.4-1934s21c1
Sequence:CCGGGGGTCTTATGTACCCATATATCTCGAGATATATGGGTACATAAGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017848.3-868s1c1
Sequence:CCGGCCCTCTTACTACAGTTCCCATCTCGAGATGGGAACTGTAGTAAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-845s1c1
Sequence:CCGGCCGAGTATGCTCTCTACAATACTCGAGTATTGTAGAGAGCATACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-2136s1c1
Sequence:CCGGCCTTAAAGAGTGGTCTGCCTACTCGAGTAGGCAGACCACTCTTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017848.3-1242s1c1
Sequence:CCGGGCGATTCAAGAAAGCAGTTGACTCGAGTCAACTGCTTTCTTGAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_017848.3-1357s1c1
Sequence:CCGGCGAAATCAAGTGGGCACCATTCTCGAGAATGGTGCCCACTTGATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198105
FAM120C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 120C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-1894s1c1
Sequence:CCGGCGTCCTTACTAAGGGTGAGATCTCGAGATCTCACCCTTAGTAAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-2092s1c1
Sequence:CCGGCCTTAAAGAGTGGTCTGCATACTCGAGTATGCAGACCACTCTTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198105.1-3592s1c1
Sequence:CCGGCCCTGTGAAGAATGGAGAGAACTCGAGTTCTCTCCATTCTTCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-1502s1c1
Sequence:CCGGGCTGTTTCTTATGACTCTAATCTCGAGATTAGAGTCATAAGAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198105.1-3213s1c1
Sequence:CCGGGCAATGGTAGAAGTAGACATTCTCGAGAATGTCTACTTCTACCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198105
FAM120C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 120C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-1894s1c1
Sequence:CCGGCGTCCTTACTAAGGGTGAGATCTCGAGATCTCACCCTTAGTAAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-2092s1c1
Sequence:CCGGCCTTAAAGAGTGGTCTGCATACTCGAGTATGCAGACCACTCTTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198105.1-3592s1c1
Sequence:CCGGCCCTGTGAAGAATGGAGAGAACTCGAGTTCTCTCCATTCTTCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-1502s1c1
Sequence:CCGGGCTGTTTCTTATGACTCTAATCTCGAGATTAGAGTCATAAGAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198105.1-3213s1c1
Sequence:CCGGGCAATGGTAGAAGTAGACATTCTCGAGAATGTCTACTTCTACCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198105
FAM120C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 120C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-1894s1c1
Sequence:CCGGCGTCCTTACTAAGGGTGAGATCTCGAGATCTCACCCTTAGTAAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-2092s1c1
Sequence:CCGGCCTTAAAGAGTGGTCTGCATACTCGAGTATGCAGACCACTCTTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198105.1-3592s1c1
Sequence:CCGGCCCTGTGAAGAATGGAGAGAACTCGAGTTCTCTCCATTCTTCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198105.1-1502s1c1
Sequence:CCGGGCTGTTTCTTATGACTCTAATCTCGAGATTAGAGTCATAAGAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198105.1-3213s1c1
Sequence:CCGGGCAATGGTAGAAGTAGACATTCTCGAGAATGTCTACTTCTACCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)