EMAIL THIS PAGE TO A FRIEND

FAM122A

family with sequence similarity 122A

Synonyms: C9orf42
UniProtKB ID: Q96E09
Gene ID:
Mouse(68034) family with sequence similarity 122, member A
Rat(309420) family with sequence similarity 122A
sheep(101108108) family with sequence similarity 122A
naked mole-rat(101725726) family with sequence similarity 122A
domestic guinea pig(100723933) family with sequence similarity 122A
chicken(422237) family with sequence similarity 122A
dog(609077) family with sequence similarity 122A
cow(539712) family with sequence similarity 122A
domestic cat(101081173) family with sequence similarity 122A
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032761 MISSION® esiRNA esiRNA human FAM122A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138333 Rosetta Predictions human pricing
NM_001014029 Rosetta Predictions rat pricing
NM_026520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223833 predicted 1154
2 SASI_Hs01_00223834 predicted 1046
3 SASI_Hs01_00223836 predicted 1157
4 SASI_Hs01_00223837 predicted 1038
5 SASI_Hs02_00363420 predicted 938
6 SASI_Hs02_00363421 predicted 739
7 SASI_Hs02_00363422 predicted 465
8 SASI_Hs01_00223838 predicted 699
9 SASI_Hs02_00363423 predicted 955
10 SASI_Hs01_00223840 predicted 1039
11 SASI_Hs01_00223835 predicted 1286
12 SASI_Hs01_00223839 predicted 1119
13 SASI_Hs01_00223841 predicted 1151
14 SASI_Hs01_00223842 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108814 predicted 996
2 SASI_Rn01_00108815 predicted 722
3 SASI_Rn01_00108817 predicted 1040
4 SASI_Rn01_00108818 predicted 1016
5 SASI_Rn01_00108820 predicted 982
6 SASI_Rn02_00201410 predicted 682
7 SASI_Rn01_00108821 predicted 625
8 SASI_Rn01_00108822 predicted 913
9 SASI_Rn01_00108823 predicted 773
10 SASI_Rn02_00201411 predicted 463
11 SASI_Rn01_00108816 predicted 455
12 SASI_Rn01_00108819 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082431 predicted 1385
2 SASI_Mm01_00082432 predicted 770
3 SASI_Mm01_00082434 predicted 1311
4 SASI_Mm01_00082435 predicted 677
5 SASI_Mm02_00330431 predicted 689
6 SASI_Mm01_00082436 predicted 1259
7 SASI_Mm02_00330432 predicted 1296
8 SASI_Mm01_00082437 predicted 1338
9 SASI_Mm01_00082439 predicted 760
10 SASI_Mm02_00330433 predicted 764
11 SASI_Mm01_00082433 predicted 513
12 SASI_Mm01_00082438 predicted 433
13 SASI_Mm01_00082440 predicted 1471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138333
VALIDATED
FAM122A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 122A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138333.2-500s1c1
Sequence:CCGGCCCAAGCGCATCGATTTCATTCTCGAGAATGAAATCGATGCGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138333.2-819s1c1
Sequence:CCGGCTTCGGATACCCTTGATGGAACTCGAGTTCCATCAAGGGTATCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-623s21c1
Sequence:CCGGGATTGCCTCCAAGCCCTATTCCTCGAGGAATAGGGCTTGGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-934s21c1
Sequence:CCGGCAAGCGGCTTCTCCATTTATTCTCGAGAATAAATGGAGAAGCCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-732s21c1
Sequence:CCGGATGTGAAATGGAAACTGAATACTCGAGTATTCAGTTTCCATTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138333.3-958s21c1
Sequence:CCGGCTAGATGAACTTTCGTCTAAGCTCGAGCTTAGACGAAAGTTCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138333.3-1056s21c1
Sequence:CCGGCAATTAATTTGAGGCTATTTCCTCGAGGAAATAGCCTCAAATTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138333
VALIDATED
FAM122A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 122A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138333.2-500s1c1
Sequence:CCGGCCCAAGCGCATCGATTTCATTCTCGAGAATGAAATCGATGCGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138333.2-819s1c1
Sequence:CCGGCTTCGGATACCCTTGATGGAACTCGAGTTCCATCAAGGGTATCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-623s21c1
Sequence:CCGGGATTGCCTCCAAGCCCTATTCCTCGAGGAATAGGGCTTGGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-934s21c1
Sequence:CCGGCAAGCGGCTTCTCCATTTATTCTCGAGAATAAATGGAGAAGCCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-732s21c1
Sequence:CCGGATGTGAAATGGAAACTGAATACTCGAGTATTCAGTTTCCATTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138333.3-958s21c1
Sequence:CCGGCTAGATGAACTTTCGTCTAAGCTCGAGCTTAGACGAAAGTTCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138333.3-1056s21c1
Sequence:CCGGCAATTAATTTGAGGCTATTTCCTCGAGGAAATAGCCTCAAATTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138333
VALIDATED
FAM122A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 122A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138333.2-500s1c1
Sequence:CCGGCCCAAGCGCATCGATTTCATTCTCGAGAATGAAATCGATGCGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138333.2-819s1c1
Sequence:CCGGCTTCGGATACCCTTGATGGAACTCGAGTTCCATCAAGGGTATCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-623s21c1
Sequence:CCGGGATTGCCTCCAAGCCCTATTCCTCGAGGAATAGGGCTTGGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-934s21c1
Sequence:CCGGCAAGCGGCTTCTCCATTTATTCTCGAGAATAAATGGAGAAGCCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138333.3-732s21c1
Sequence:CCGGATGTGAAATGGAAACTGAATACTCGAGTATTCAGTTTCCATTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138333.3-958s21c1
Sequence:CCGGCTAGATGAACTTTCGTCTAAGCTCGAGCTTAGACGAAAGTTCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138333.3-1056s21c1
Sequence:CCGGCAATTAATTTGAGGCTATTTCCTCGAGGAAATAGCCTCAAATTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026520
FAM122A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 122A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026520.2-1520s1c1
Sequence:CCGGCCCTTGGTATTTAATGTCCTACTCGAGTAGGACATTAAATACCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-738s1c1
Sequence:CCGGCTGATTATCAGCCAAAGAGATCTCGAGATCTCTTTGGCTGATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-509s1c1
Sequence:CCGGCCGAAGCGCATCGATTTCATTCTCGAGAATGAAATCGATGCGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-726s21c1
Sequence:CCGGGTGAAATGGAAACTGATTATCCTCGAGGATAATCAGTTTCCATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026520.3-1074s21c1
Sequence:CCGGACTTTGTCGATTACGTTAAAGCTCGAGCTTTAACGTAATCGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-950s1c1
Sequence:CCGGGTAGATGAACTTTCCTCAAAGCTCGAGCTTTGAGGAAAGTTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-672s21c1
Sequence:CCGGAGAGTCCCATCAACTGCATTACTCGAGTAATGCAGTTGATGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-510s21c1
Sequence:CCGGCGAAGCGCATCGATTTCATTCCTCGAGGAATGAAATCGATGCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-943s21c1
Sequence:CCGGTATTCCAGTAGATGAACTTTCCTCGAGGAAAGTTCATCTACTGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026520
FAM122A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 122A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026520.2-1520s1c1
Sequence:CCGGCCCTTGGTATTTAATGTCCTACTCGAGTAGGACATTAAATACCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-738s1c1
Sequence:CCGGCTGATTATCAGCCAAAGAGATCTCGAGATCTCTTTGGCTGATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-509s1c1
Sequence:CCGGCCGAAGCGCATCGATTTCATTCTCGAGAATGAAATCGATGCGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-726s21c1
Sequence:CCGGGTGAAATGGAAACTGATTATCCTCGAGGATAATCAGTTTCCATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026520.3-1074s21c1
Sequence:CCGGACTTTGTCGATTACGTTAAAGCTCGAGCTTTAACGTAATCGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-950s1c1
Sequence:CCGGGTAGATGAACTTTCCTCAAAGCTCGAGCTTTGAGGAAAGTTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-672s21c1
Sequence:CCGGAGAGTCCCATCAACTGCATTACTCGAGTAATGCAGTTGATGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-510s21c1
Sequence:CCGGCGAAGCGCATCGATTTCATTCCTCGAGGAATGAAATCGATGCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-943s21c1
Sequence:CCGGTATTCCAGTAGATGAACTTTCCTCGAGGAAAGTTCATCTACTGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026520
FAM122A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 122A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026520.2-1520s1c1
Sequence:CCGGCCCTTGGTATTTAATGTCCTACTCGAGTAGGACATTAAATACCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-738s1c1
Sequence:CCGGCTGATTATCAGCCAAAGAGATCTCGAGATCTCTTTGGCTGATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-509s1c1
Sequence:CCGGCCGAAGCGCATCGATTTCATTCTCGAGAATGAAATCGATGCGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-726s21c1
Sequence:CCGGGTGAAATGGAAACTGATTATCCTCGAGGATAATCAGTTTCCATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026520.3-1074s21c1
Sequence:CCGGACTTTGTCGATTACGTTAAAGCTCGAGCTTTAACGTAATCGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026520.2-950s1c1
Sequence:CCGGGTAGATGAACTTTCCTCAAAGCTCGAGCTTTGAGGAAAGTTCATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-672s21c1
Sequence:CCGGAGAGTCCCATCAACTGCATTACTCGAGTAATGCAGTTGATGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-510s21c1
Sequence:CCGGCGAAGCGCATCGATTTCATTCCTCGAGGAATGAAATCGATGCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026520.3-943s21c1
Sequence:CCGGTATTCCAGTAGATGAACTTTCCTCGAGGAAAGTTCATCTACTGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks