EMAIL THIS PAGE TO A FRIEND

FAM122B

family with sequence similarity 122B

215 Gene Product Result for
Synonyms: SPACIA2
Gene ID:
Mouse(78755) family with sequence similarity 122, member B
Rat(501647) family with sequence similarity 122B
Zebrafish(445072) family with sequence similarity 122B
chicken(422236) family with sequence similarity 122B
cow(787049) family with sequence similarity 122B
domestic cat(101088313) family with sequence similarity 122B
dog(492149) family with sequence similarity 122B
domestic guinea pig(100722680) family with sequence similarity 122B
naked mole-rat(101715307) family with sequence similarity 122B
sheep(101107673) family with sequence similarity 122B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145284 Rosetta Predictions human pricing
XM_001054191 Rosetta Predictions rat pricing
XM_577043 Rosetta Predictions rat pricing
NM_030167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074423 predicted 1245
2 SASI_Hs02_00365161 predicted 726
3 SASI_Hs02_00365162 predicted 562
4 SASI_Hs01_00074426 predicted 1112
5 SASI_Hs02_00365163 predicted 630
6 SASI_Hs02_00365164 predicted 1164
7 SASI_Hs01_00074428 predicted 738
8 SASI_Hs01_00074429 predicted 1177
9 SASI_Hs01_00074430 predicted 1234
10 SASI_Hs01_00074431 predicted 1242
11 SASI_Hs01_00074424 predicted 1127
12 SASI_Hs01_00074425 predicted 1252
13 SASI_Hs01_00074427 predicted 1176
14 SASI_Hs01_00074432 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275012 predicted 811
2 SASI_Rn02_00275013 predicted 363
3 SASI_Rn02_00275014 predicted 907
4 SASI_Rn02_00275015 predicted 619
5 SASI_Rn02_00275016 predicted 482
6 SASI_Rn02_00275017 predicted 661
7 SASI_Rn02_00275018 predicted 273
8 SASI_Rn02_00275019 predicted 811
9 SASI_Rn02_00275020 predicted 897
10 SASI_Rn02_00275021 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406094 predicted 804
2 SASI_Rn02_00406095 predicted 360
3 SASI_Rn02_00406096 predicted 910
4 SASI_Rn02_00406097 predicted 613
5 SASI_Rn02_00406098 predicted 481
6 SASI_Rn02_00406099 predicted 653
7 SASI_Rn02_00406100 predicted 279
8 SASI_Rn02_00406101 predicted 818
9 SASI_Rn02_00406102 predicted 892
10 SASI_Rn02_00406103 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081947 predicted 779
2 SASI_Mm01_00081948 predicted 378
3 SASI_Mm01_00081949 predicted 926
4 SASI_Mm01_00081950 predicted 821
5 SASI_Mm01_00081951 predicted 769
6 SASI_Mm01_00081952 predicted 667
7 SASI_Mm01_00081953 predicted 653
8 SASI_Mm01_00081955 predicted 912
9 SASI_Mm01_00081956 predicted 202
10 SASI_Mm02_00336578 predicted 417
11 SASI_Mm01_00081954 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145284
VALIDATED
FAM122B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 122B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-602s21c1
Sequence:CCGGAGAGTCCAGTCAAGTGCATTACTCGAGTAATGCACTTGACTGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-696s21c1
Sequence:CCGGAGGCACTACCAATATGTTATCCTCGAGGATAACATATTGGTAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145284.5-923s21c1
Sequence:CCGGTAACTGCTGTTTCCTACATAACTCGAGTTATGTAGGAAACAGCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-441s21c1
Sequence:CCGGTGACAAGCCGGAGAAATTATACTCGAGTATAATTTCTCCGGCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-1528s1c1
Sequence:CCGGGCAGCAGTGATATGACAGATTCTCGAGAATCTGTCATATCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145284.3-970s1c1
Sequence:CCGGCCAAGGCACTACCAATATGTTCTCGAGAACATATTGGTAGTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145284.3-1238s1c1
Sequence:CCGGGCAGAGAACTTTGATCCATAACTCGAGTTATGGATCAAAGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128808    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145284.3-1237s1c1
Sequence:CCGGCGCAGAGAACTTTGATCCATACTCGAGTATGGATCAAAGTTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-566s1c1
Sequence:CCGGCGGAGGAATAGTACAACAATTCTCGAGAATTGTTGTACTATTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-903s1c1
Sequence:CCGGCCAGTGTTCTTGGTCCTCTTACTCGAGTAAGAGGACCAAGAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-2886s1c1
Sequence:CCGGGCATCCGATGTGTCCTTTATTCTCGAGAATAAAGGACACATCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145284.3-555s1c1
Sequence:CCGGCACTTAGAACTCGGAGGAATACTCGAGTATTCCTCCGAGTTCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145284
VALIDATED
FAM122B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 122B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-602s21c1
Sequence:CCGGAGAGTCCAGTCAAGTGCATTACTCGAGTAATGCACTTGACTGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-696s21c1
Sequence:CCGGAGGCACTACCAATATGTTATCCTCGAGGATAACATATTGGTAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145284.5-923s21c1
Sequence:CCGGTAACTGCTGTTTCCTACATAACTCGAGTTATGTAGGAAACAGCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-441s21c1
Sequence:CCGGTGACAAGCCGGAGAAATTATACTCGAGTATAATTTCTCCGGCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-1528s1c1
Sequence:CCGGGCAGCAGTGATATGACAGATTCTCGAGAATCTGTCATATCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145284.3-970s1c1
Sequence:CCGGCCAAGGCACTACCAATATGTTCTCGAGAACATATTGGTAGTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145284.3-1238s1c1
Sequence:CCGGGCAGAGAACTTTGATCCATAACTCGAGTTATGGATCAAAGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128808    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145284.3-1237s1c1
Sequence:CCGGCGCAGAGAACTTTGATCCATACTCGAGTATGGATCAAAGTTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-566s1c1
Sequence:CCGGCGGAGGAATAGTACAACAATTCTCGAGAATTGTTGTACTATTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-903s1c1
Sequence:CCGGCCAGTGTTCTTGGTCCTCTTACTCGAGTAAGAGGACCAAGAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-2886s1c1
Sequence:CCGGGCATCCGATGTGTCCTTTATTCTCGAGAATAAAGGACACATCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145284.3-555s1c1
Sequence:CCGGCACTTAGAACTCGGAGGAATACTCGAGTATTCCTCCGAGTTCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145284
VALIDATED
FAM122B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 122B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-602s21c1
Sequence:CCGGAGAGTCCAGTCAAGTGCATTACTCGAGTAATGCACTTGACTGGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-696s21c1
Sequence:CCGGAGGCACTACCAATATGTTATCCTCGAGGATAACATATTGGTAGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145284.5-923s21c1
Sequence:CCGGTAACTGCTGTTTCCTACATAACTCGAGTTATGTAGGAAACAGCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145284.5-441s21c1
Sequence:CCGGTGACAAGCCGGAGAAATTATACTCGAGTATAATTTCTCCGGCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-1528s1c1
Sequence:CCGGGCAGCAGTGATATGACAGATTCTCGAGAATCTGTCATATCACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145284.3-970s1c1
Sequence:CCGGCCAAGGCACTACCAATATGTTCTCGAGAACATATTGGTAGTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145284.3-1238s1c1
Sequence:CCGGGCAGAGAACTTTGATCCATAACTCGAGTTATGGATCAAAGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128808    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145284.3-1237s1c1
Sequence:CCGGCGCAGAGAACTTTGATCCATACTCGAGTATGGATCAAAGTTCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-566s1c1
Sequence:CCGGCGGAGGAATAGTACAACAATTCTCGAGAATTGTTGTACTATTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-903s1c1
Sequence:CCGGCCAGTGTTCTTGGTCCTCTTACTCGAGTAAGAGGACCAAGAACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145284.3-2886s1c1
Sequence:CCGGGCATCCGATGTGTCCTTTATTCTCGAGAATAAAGGACACATCGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145284.3-555s1c1
Sequence:CCGGCACTTAGAACTCGGAGGAATACTCGAGTATTCCTCCGAGTTCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030167
VALIDATED
FAM122B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 122B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030167.1-246s1c1
Sequence:CCGGCTGGATATGATGAACAGAGAACTCGAGTTCTCTGTTCATCATATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030167.1-891s1c1
Sequence:CCGGGCGGAGAACTTTGATCCACAACTCGAGTTGTGGATCAAAGTTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030167.1-495s1c1
Sequence:CCGGCCTGTTCTCAATCCAAGACATCTCGAGATGTCTTGGATTGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030167.1-211s1c1
Sequence:CCGGCGGCAATTATGAGCCATCATACTCGAGTATGATGGCTCATAATTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030167.1-704s1c1
Sequence:CCGGCAGTAGTATCAGCAGTGGCTTCTCGAGAAGCCACTGCTGATACTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030167.1-1109s1c1
Sequence:CCGGGCACCTACTTTCAAACATTTACTCGAGTAAATGTTTGAAAGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030167
VALIDATED
FAM122B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 122B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030167.1-246s1c1
Sequence:CCGGCTGGATATGATGAACAGAGAACTCGAGTTCTCTGTTCATCATATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030167.1-891s1c1
Sequence:CCGGGCGGAGAACTTTGATCCACAACTCGAGTTGTGGATCAAAGTTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030167.1-495s1c1
Sequence:CCGGCCTGTTCTCAATCCAAGACATCTCGAGATGTCTTGGATTGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030167.1-211s1c1
Sequence:CCGGCGGCAATTATGAGCCATCATACTCGAGTATGATGGCTCATAATTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030167.1-704s1c1
Sequence:CCGGCAGTAGTATCAGCAGTGGCTTCTCGAGAAGCCACTGCTGATACTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030167.1-1109s1c1
Sequence:CCGGGCACCTACTTTCAAACATTTACTCGAGTAAATGTTTGAAAGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030167
VALIDATED
FAM122B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 122B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030167.1-246s1c1
Sequence:CCGGCTGGATATGATGAACAGAGAACTCGAGTTCTCTGTTCATCATATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030167.1-891s1c1
Sequence:CCGGGCGGAGAACTTTGATCCACAACTCGAGTTGTGGATCAAAGTTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030167.1-495s1c1
Sequence:CCGGCCTGTTCTCAATCCAAGACATCTCGAGATGTCTTGGATTGAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030167.1-211s1c1
Sequence:CCGGCGGCAATTATGAGCCATCATACTCGAGTATGATGGCTCATAATTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030167.1-704s1c1
Sequence:CCGGCAGTAGTATCAGCAGTGGCTTCTCGAGAAGCCACTGCTGATACTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030167.1-1109s1c1
Sequence:CCGGGCACCTACTTTCAAACATTTACTCGAGTAAATGTTTGAAAGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks