EMAIL THIS PAGE TO A FRIEND

FAM122C

family with sequence similarity 122C

131 Gene Product Result for
UniProtKB ID: Q6P4D5, F5H036, Q8WVK9
Gene ID:
Mouse(73866) family with sequence similarity 122, member C
Rat(685701) family with sequence similarity 122C
sheep(101118511) family with sequence similarity 122C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069701 MISSION® esiRNA esiRNA targeting mouse Fam122c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138819 Rosetta Predictions human pricing
XM_001064897 Rosetta Predictions rat pricing
NM_028671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212411 predicted 772
2 SASI_Hs01_00212412 predicted 526
3 SASI_Hs01_00212413 predicted 952
4 SASI_Hs01_00212414 predicted 706
5 SASI_Hs01_00212415 predicted 562
6 SASI_Hs01_00212416 predicted 936
7 SASI_Hs01_00212418 predicted 778
8 SASI_Hs01_00212419 predicted 696
9 SASI_Hs02_00363988 predicted 879
10 SASI_Hs02_00363989 predicted 533
11 SASI_Hs01_00212417 predicted 692
12 SASI_Hs01_00212420 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312162 predicted 512
2 SASI_Rn02_00312163 predicted 279
3 SASI_Rn02_00312164 predicted 469
4 SASI_Rn02_00312165 predicted 347
5 SASI_Rn02_00312166 predicted 339
6 SASI_Rn02_00312167 predicted 393
7 SASI_Rn02_00312168 predicted 502
8 SASI_Rn02_00312169 predicted 270
9 SASI_Rn02_00312170 predicted 355
10 SASI_Rn02_00312171 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173086 predicted 247
2 SASI_Mm02_00334226 predicted 473
3 SASI_Mm01_00173089 predicted 357
4 SASI_Mm01_00173091 predicted 217
5 SASI_Mm01_00173092 predicted 205
6 SASI_Mm01_00173093 predicted 221
7 SASI_Mm01_00173094 predicted 399
8 SASI_Mm01_00173095 predicted 427
9 SASI_Mm02_00334227 predicted 203
10 SASI_Mm02_00334228 predicted 254
11 SASI_Mm01_00173087 predicted 250
12 SASI_Mm01_00173088 predicted 669
13 SASI_Mm01_00173090 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028671
FAM122C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 122C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-332s1c1
Sequence:CCGGCAGCATGGATTGCTGTTTCTACTCGAGTAGAAACAGCAATCCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-520s1c1
Sequence:CCGGGTCATCCACTATGAGGAACATCTCGAGATGTTCCTCATAGTGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-404s1c1
Sequence:CCGGGAAGGGATGGATATGGCAATTCTCGAGAATTGCCATATCCATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-322s1c1
Sequence:CCGGCTTTCTGAATCAGCATGGATTCTCGAGAATCCATGCTGATTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028671
FAM122C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 122C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-332s1c1
Sequence:CCGGCAGCATGGATTGCTGTTTCTACTCGAGTAGAAACAGCAATCCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-520s1c1
Sequence:CCGGGTCATCCACTATGAGGAACATCTCGAGATGTTCCTCATAGTGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-404s1c1
Sequence:CCGGGAAGGGATGGATATGGCAATTCTCGAGAATTGCCATATCCATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-322s1c1
Sequence:CCGGCTTTCTGAATCAGCATGGATTCTCGAGAATCCATGCTGATTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028671
FAM122C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 122C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-332s1c1
Sequence:CCGGCAGCATGGATTGCTGTTTCTACTCGAGTAGAAACAGCAATCCATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-520s1c1
Sequence:CCGGGTCATCCACTATGAGGAACATCTCGAGATGTTCCTCATAGTGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-404s1c1
Sequence:CCGGGAAGGGATGGATATGGCAATTCTCGAGAATTGCCATATCCATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028671.1-322s1c1
Sequence:CCGGCTTTCTGAATCAGCATGGATTCTCGAGAATCCATGCTGATTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138819
VALIDATED
FAM122C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 122C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138819.1-551s1c1
Sequence:CCGGGAATTAGGACAAACAGAACAACTCGAGTTGTTCTGTTTGTCCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138819.1-1057s1c1
Sequence:CCGGGCAATGAGAATTGTACTGTATCTCGAGATACAGTACAATTCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-624s21c1
Sequence:CCGGCATCAGCCGCCTTCATCAAATCTCGAGATTTGATGAAGGCGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138819.2-880s21c1
Sequence:CCGGTGCTGGATCTTCTGGTAATTCCTCGAGGAATTACCAGAAGATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-777s21c1
Sequence:CCGGCTCTCTAAAGTGCATTGATTTCTCGAGAAATCAATGCACTTTAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-650s21c1
Sequence:CCGGAGGAAGAAGCCATGGATTTAACTCGAGTTAAATCCATGGCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138819.2-530s21c1
Sequence:CCGGTGTTGCAAGCTGACATGTTAACTCGAGTTAACATGTCAGCTTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138819
VALIDATED
FAM122C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 122C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138819.1-551s1c1
Sequence:CCGGGAATTAGGACAAACAGAACAACTCGAGTTGTTCTGTTTGTCCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138819.1-1057s1c1
Sequence:CCGGGCAATGAGAATTGTACTGTATCTCGAGATACAGTACAATTCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-624s21c1
Sequence:CCGGCATCAGCCGCCTTCATCAAATCTCGAGATTTGATGAAGGCGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138819.2-880s21c1
Sequence:CCGGTGCTGGATCTTCTGGTAATTCCTCGAGGAATTACCAGAAGATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-777s21c1
Sequence:CCGGCTCTCTAAAGTGCATTGATTTCTCGAGAAATCAATGCACTTTAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-650s21c1
Sequence:CCGGAGGAAGAAGCCATGGATTTAACTCGAGTTAAATCCATGGCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138819.2-530s21c1
Sequence:CCGGTGTTGCAAGCTGACATGTTAACTCGAGTTAACATGTCAGCTTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138819
VALIDATED
FAM122C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 122C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138819.1-551s1c1
Sequence:CCGGGAATTAGGACAAACAGAACAACTCGAGTTGTTCTGTTTGTCCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138819.1-1057s1c1
Sequence:CCGGGCAATGAGAATTGTACTGTATCTCGAGATACAGTACAATTCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-624s21c1
Sequence:CCGGCATCAGCCGCCTTCATCAAATCTCGAGATTTGATGAAGGCGGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138819.2-880s21c1
Sequence:CCGGTGCTGGATCTTCTGGTAATTCCTCGAGGAATTACCAGAAGATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-777s21c1
Sequence:CCGGCTCTCTAAAGTGCATTGATTTCTCGAGAAATCAATGCACTTTAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138819.2-650s21c1
Sequence:CCGGAGGAAGAAGCCATGGATTTAACTCGAGTTAAATCCATGGCTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138819.2-530s21c1
Sequence:CCGGTGTTGCAAGCTGACATGTTAACTCGAGTTAACATGTCAGCTTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks