EMAIL THIS PAGE TO A FRIEND

FAM124A

family with sequence similarity 124A

65 Gene Product Result for
UniProtKB ID: Q86V42, A2A324, Q8N8P9, Q8NE66, Q96NJ9
Gene ID:
Mouse(629059) family with sequence similarity 124, member A
Rat(691938) family with sequence similarity 124A
chicken(770395) family with sequence similarity 124A
cow(539638) family with sequence similarity 124A
domestic cat(101098352) family with sequence similarity 124A
sheep(101119402) family with sequence similarity 124A
domestic guinea pig(100732425) family with sequence similarity 124A
naked mole-rat(101717506) family with sequence similarity 124A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145019 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083621 MISSION® esiRNA esiRNA human FAM124A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145019 Rosetta Predictions human pricing
XM_001080220 Rosetta Predictions rat pricing
XM_127791 Rosetta Predictions mouse pricing
XM_912389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043270 predicted 737
2 SASI_Hs01_00043271 predicted 1053
3 SASI_Hs01_00043272 predicted 1858
4 SASI_Hs01_00043273 predicted 1851
5 SASI_Hs01_00043274 predicted 1262
6 SASI_Hs01_00043275 predicted 792
7 SASI_Hs01_00043276 predicted 761
8 SASI_Hs01_00043277 predicted 960
9 SASI_Hs01_00043278 predicted 882
10 SASI_Hs01_00043279 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367138 predicted 349
2 SASI_Rn02_00367139 predicted 378
3 SASI_Rn02_00367140 predicted 378
4 SASI_Rn02_00367141 predicted 316
5 SASI_Rn02_00367142 predicted 424
6 SASI_Rn02_00367143 predicted 367
7 SASI_Rn02_00367144 predicted 390
8 SASI_Rn02_00367145 predicted 567
9 SASI_Rn02_00367146 predicted 557
10 SASI_Rn02_00367147 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272322 predicted 308
2 SASI_Mm02_00424239 predicted 310
3 SASI_Mm02_00424240 predicted 306
4 SASI_Mm02_00424241 predicted 2056
5 SASI_Mm02_00424242 predicted 2023
6 SASI_Mm02_00424243 predicted 272
7 SASI_Mm02_00424244 predicted 2034
8 SASI_Mm02_00424245 predicted 2092
9 SASI_Mm02_00424246 predicted 2006
10 SASI_Mm02_00424247 predicted 2035
11 SASI_Mm01_00272313 predicted 1571
12 SASI_Mm01_00272314 predicted 1240
13 SASI_Mm01_00272315 predicted 1226
14 SASI_Mm01_00272316 predicted 1200
15 SASI_Mm01_00272317 predicted 1267
16 SASI_Mm01_00272318 predicted 1032
17 SASI_Mm01_00272319 predicted 1504
18 SASI_Mm01_00272320 predicted 1822
19 SASI_Mm01_00272321 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437015 predicted 1563
2 SASI_Mm02_00437016 predicted 1217
3 SASI_Mm02_00437017 predicted 1818
4 SASI_Mm02_00437018 predicted 1197
5 SASI_Mm02_00437019 predicted 1256
6 SASI_Mm02_00437020 predicted 1491
7 SASI_Mm02_00437021 predicted 1818
8 SASI_Mm02_00437022 predicted 304
9 SASI_Mm02_00437023 predicted 1758
10 SASI_Mm02_00437024 predicted 1133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145019
FAM124A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 124A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-1438s21c1
Sequence:CCGGTCCTCTCCATCGATGACCTAGCTCGAGCTAGGTCATCGATGGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-274s21c1
Sequence:CCGGACTGTACACACGGTGACAAAGCTCGAGCTTTGTCACCGTGTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145019.2-1886s21c1
Sequence:CCGGCTCTGCTCTTGTTCTCGAAACCTCGAGGTTTCGAGAACAAGAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-308s21c1
Sequence:CCGGGAGCCTCCAGGTTGAACATACCTCGAGGTATGTTCAACCTGGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-1513s21c1
Sequence:CCGGTGTCTGTGGTCTCTGCATATTCTCGAGAATATGCAGAGACCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145019.2-1901s1c1
Sequence:CCGGCGAAACACACAAACTCAGAGACTCGAGTCTCTGAGTTTGTGTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145019.2-1083s1c1
Sequence:CCGGGTGCATAAGAAGTTTCCTAAACTCGAGTTTAGGAAACTTCTTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145019.2-842s1c1
Sequence:CCGGGAAAGCGGACTTCTGCATCTTCTCGAGAAGATGCAGAAGTCCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145019
FAM124A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 124A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-1438s21c1
Sequence:CCGGTCCTCTCCATCGATGACCTAGCTCGAGCTAGGTCATCGATGGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-274s21c1
Sequence:CCGGACTGTACACACGGTGACAAAGCTCGAGCTTTGTCACCGTGTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145019.2-1886s21c1
Sequence:CCGGCTCTGCTCTTGTTCTCGAAACCTCGAGGTTTCGAGAACAAGAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-308s21c1
Sequence:CCGGGAGCCTCCAGGTTGAACATACCTCGAGGTATGTTCAACCTGGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-1513s21c1
Sequence:CCGGTGTCTGTGGTCTCTGCATATTCTCGAGAATATGCAGAGACCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145019.2-1901s1c1
Sequence:CCGGCGAAACACACAAACTCAGAGACTCGAGTCTCTGAGTTTGTGTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145019.2-1083s1c1
Sequence:CCGGGTGCATAAGAAGTTTCCTAAACTCGAGTTTAGGAAACTTCTTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145019.2-842s1c1
Sequence:CCGGGAAAGCGGACTTCTGCATCTTCTCGAGAAGATGCAGAAGTCCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145019
FAM124A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 124A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-1438s21c1
Sequence:CCGGTCCTCTCCATCGATGACCTAGCTCGAGCTAGGTCATCGATGGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-274s21c1
Sequence:CCGGACTGTACACACGGTGACAAAGCTCGAGCTTTGTCACCGTGTGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145019.2-1886s21c1
Sequence:CCGGCTCTGCTCTTGTTCTCGAAACCTCGAGGTTTCGAGAACAAGAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-308s21c1
Sequence:CCGGGAGCCTCCAGGTTGAACATACCTCGAGGTATGTTCAACCTGGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145019.2-1513s21c1
Sequence:CCGGTGTCTGTGGTCTCTGCATATTCTCGAGAATATGCAGAGACCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145019.2-1901s1c1
Sequence:CCGGCGAAACACACAAACTCAGAGACTCGAGTCTCTGAGTTTGTGTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145019.2-1083s1c1
Sequence:CCGGGTGCATAAGAAGTTTCCTAAACTCGAGTTTAGGAAACTTCTTATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145019.2-842s1c1
Sequence:CCGGGAAAGCGGACTTCTGCATCTTCTCGAGAAGATGCAGAAGTCCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks