EMAIL THIS PAGE TO A FRIEND

FAM124B

family with sequence similarity 124B

94 Gene Product Result for
UniProtKB ID: Q9H5Z6, A6NNC7, Q8NBZ4, Q8TAV7
Gene ID:
Mouse(241128) family with sequence similarity 124, member B
Rat(690912) family with sequence similarity 124B
naked mole-rat(101696707) family with sequence similarity 124B
domestic guinea pig(100729609) family with sequence similarity 124B
sheep(101122416) family with sequence similarity 124B
chicken(771342) family with sequence similarity 124B
dog(486144) family with sequence similarity 124B
domestic cat(101085651) family with sequence similarity 124B
cow(506367) family with sequence similarity 124B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067861 MISSION® esiRNA esiRNA human FAM124B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122779 Rosetta Predictions human pricing
NM_024785 Rosetta Predictions human pricing
XM_001076121 Rosetta Predictions rat pricing
NM_173425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327345 predicted 2000
2 SASI_Hs02_00327346 predicted 1318
3 SASI_Hs02_00327347 predicted 1867
4 SASI_Hs02_00327348 predicted 421
5 SASI_Hs02_00327349 predicted 1286
6 SASI_Hs02_00327350 predicted 460
7 SASI_Hs02_00327351 predicted 1999
8 SASI_Hs02_00327352 predicted 1915
9 SASI_Hs02_00327353 predicted 691
10 SASI_Hs02_00327354 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142365 predicted 1443
2 SASI_Hs01_00142366 predicted 675
3 SASI_Hs02_00357327 predicted 674
4 SASI_Hs01_00142367 predicted 1411
5 SASI_Hs01_00142370 predicted 253
6 SASI_Hs01_00142371 predicted 364
7 SASI_Hs01_00142372 predicted 482
8 SASI_Hs02_00357328 predicted 371
9 SASI_Hs01_00142374 predicted 441
10 SASI_Hs02_00357329 predicted 424
11 SASI_Hs01_00142368 predicted 708
12 SASI_Hs01_00142369 predicted 253
13 SASI_Hs01_00142373 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352115 predicted 282
2 SASI_Rn02_00352116 predicted 299
3 SASI_Rn02_00352117 predicted 914
4 SASI_Rn02_00352118 predicted 1278
5 SASI_Rn02_00352119 predicted 210
6 SASI_Rn02_00352120 predicted 1305
7 SASI_Rn02_00352121 predicted 342
8 SASI_Rn02_00352122 predicted 1025
9 SASI_Rn02_00352123 predicted 680
10 SASI_Rn02_00352124 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028771 predicted 978
2 SASI_Mm01_00028773 predicted 1996
3 SASI_Mm01_00028774 predicted 664
4 SASI_Mm01_00028775 predicted 1322
5 SASI_Mm01_00028776 predicted 2016
6 SASI_Mm01_00028777 predicted 403
7 SASI_Mm01_00028778 predicted 2046
8 SASI_Mm01_00028779 predicted 2034
9 SASI_Mm01_00028780 predicted 789
10 SASI_Mm02_00345305 predicted 664
11 SASI_Mm01_00028772 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024785
FAM124B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 124B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-256s1c1
Sequence:CCGGGACTGTCCATCTTCTTGCCAACTCGAGTTGGCAAGAAGATGGACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-935s1c1
Sequence:CCGGGATGGCAACAAGATTCTGCTTCTCGAGAAGCAGAATCTTGTTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024785.2-1634s1c1
Sequence:CCGGCCAGGAAGACAATTTCAGAATCTCGAGATTCTGAAATTGTCTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-838s1c1
Sequence:CCGGGCTGCAGTTTAAGGTTCAAGACTCGAGTCTTGAACCTTAAACTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-1021s1c1
Sequence:CCGGGTCTTCACCTTCTGGGTTCAACTCGAGTTGAACCCAGAAGGTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-851s1c1
Sequence:CCGGGTTCAAGAGATCGGCCAGTTACTCGAGTAACTGGCCGATCTCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024785.2-2002s1c1
Sequence:CCGGCCAGCACCTATCAGGATAATTCTCGAGAATTATCCTGATAGGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-695s1c1
Sequence:CCGGGAGATGATCCTGCAGAGAGAACTCGAGTTCTCTCTGCAGGATCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024785.2-312s21c1
Sequence:CCGGACCAGCTCCTGGATTGCATTTCTCGAGAAATGCAATCCAGGAGCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024785.2-1092s21c1
Sequence:CCGGGAATCCAGAACTTGGTGTTAACTCGAGTTAACACCAAGTTCTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024785.2-1467s21c1
Sequence:CCGGTGAACCCAGGCAGACTTATTTCTCGAGAAATAAGTCTGCCTGGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024785
FAM124B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 124B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-256s1c1
Sequence:CCGGGACTGTCCATCTTCTTGCCAACTCGAGTTGGCAAGAAGATGGACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-935s1c1
Sequence:CCGGGATGGCAACAAGATTCTGCTTCTCGAGAAGCAGAATCTTGTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024785.2-1634s1c1
Sequence:CCGGCCAGGAAGACAATTTCAGAATCTCGAGATTCTGAAATTGTCTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-838s1c1
Sequence:CCGGGCTGCAGTTTAAGGTTCAAGACTCGAGTCTTGAACCTTAAACTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-1021s1c1
Sequence:CCGGGTCTTCACCTTCTGGGTTCAACTCGAGTTGAACCCAGAAGGTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-851s1c1
Sequence:CCGGGTTCAAGAGATCGGCCAGTTACTCGAGTAACTGGCCGATCTCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024785.2-2002s1c1
Sequence:CCGGCCAGCACCTATCAGGATAATTCTCGAGAATTATCCTGATAGGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-695s1c1
Sequence:CCGGGAGATGATCCTGCAGAGAGAACTCGAGTTCTCTCTGCAGGATCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024785.2-312s21c1
Sequence:CCGGACCAGCTCCTGGATTGCATTTCTCGAGAAATGCAATCCAGGAGCTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024785.2-1092s21c1
Sequence:CCGGGAATCCAGAACTTGGTGTTAACTCGAGTTAACACCAAGTTCTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024785.2-1467s21c1
Sequence:CCGGTGAACCCAGGCAGACTTATTTCTCGAGAAATAAGTCTGCCTGGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024785
FAM124B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 124B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-256s1c1
Sequence:CCGGGACTGTCCATCTTCTTGCCAACTCGAGTTGGCAAGAAGATGGACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-935s1c1
Sequence:CCGGGATGGCAACAAGATTCTGCTTCTCGAGAAGCAGAATCTTGTTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024785.2-1634s1c1
Sequence:CCGGCCAGGAAGACAATTTCAGAATCTCGAGATTCTGAAATTGTCTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-838s1c1
Sequence:CCGGGCTGCAGTTTAAGGTTCAAGACTCGAGTCTTGAACCTTAAACTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-1021s1c1
Sequence:CCGGGTCTTCACCTTCTGGGTTCAACTCGAGTTGAACCCAGAAGGTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024785.2-851s1c1
Sequence:CCGGGTTCAAGAGATCGGCCAGTTACTCGAGTAACTGGCCGATCTCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024785.2-2002s1c1
Sequence:CCGGCCAGCACCTATCAGGATAATTCTCGAGAATTATCCTGATAGGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024785.2-695s1c1
Sequence:CCGGGAGATGATCCTGCAGAGAGAACTCGAGTTCTCTCTGCAGGATCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024785.2-312s21c1
Sequence:CCGGACCAGCTCCTGGATTGCATTTCTCGAGAAATGCAATCCAGGAGCTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024785.2-1092s21c1
Sequence:CCGGGAATCCAGAACTTGGTGTTAACTCGAGTTAACACCAAGTTCTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024785.2-1467s21c1
Sequence:CCGGTGAACCCAGGCAGACTTATTTCTCGAGAAATAAGTCTGCCTGGGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173425
FAM124B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 124B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173425.1-1724s1c1
Sequence:CCGGCCTTTGTAGTTGAAATGAGAACTCGAGTTCTCATTTCAACTACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173425.1-1557s1c1
Sequence:CCGGCCTAGTCAAAGGGACTTTGGTCTCGAGACCAAAGTCCCTTTGACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173425.1-2426s1c1
Sequence:CCGGGCCTTTAAAGTTCTTTGCATACTCGAGTATGCAAAGAACTTTAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173425.1-1511s1c1
Sequence:CCGGCCCAAACCAAGGAGTCTTTAACTCGAGTTAAAGACTCCTTGGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173425
FAM124B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 124B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173425.1-1724s1c1
Sequence:CCGGCCTTTGTAGTTGAAATGAGAACTCGAGTTCTCATTTCAACTACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173425.1-1557s1c1
Sequence:CCGGCCTAGTCAAAGGGACTTTGGTCTCGAGACCAAAGTCCCTTTGACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173425.1-2426s1c1
Sequence:CCGGGCCTTTAAAGTTCTTTGCATACTCGAGTATGCAAAGAACTTTAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173425.1-1511s1c1
Sequence:CCGGCCCAAACCAAGGAGTCTTTAACTCGAGTTAAAGACTCCTTGGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173425
FAM124B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 124B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173425.1-1724s1c1
Sequence:CCGGCCTTTGTAGTTGAAATGAGAACTCGAGTTCTCATTTCAACTACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173425.1-1557s1c1
Sequence:CCGGCCTAGTCAAAGGGACTTTGGTCTCGAGACCAAAGTCCCTTTGACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173425.1-2426s1c1
Sequence:CCGGGCCTTTAAAGTTCTTTGCATACTCGAGTATGCAAAGAACTTTAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173425.1-1511s1c1
Sequence:CCGGCCCAAACCAAGGAGTCTTTAACTCGAGTTAAAGACTCCTTGGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)