EMAIL THIS PAGE TO A FRIEND

FAM126A

family with sequence similarity 126, member A

194 Gene Product Result for
Synonyms: DRCTNNB1A HCC HLD5 HYCC1
Gene ID:
Human(84668) Summary: The protein encoded by this gene may play a part in the beta-catenin/Lef signaling pathway. Expression of this gene is down-regulated by beta-catenin. Defects in this gene are a cause of hypomyelination with congenital cataract (HCC). [provided by RefSeq, Oct 2008]
Mouse(84652) family with sequence similarity 126, member A
Rat(499975) family with sequence similarity 126, member A
Zebrafish(402926) family with sequence similarity 126, member A
cow(540584) family with sequence similarity 126, member A
domestic cat(101088738) family with sequence similarity 126, member A
dog(475254) family with sequence similarity 126, member A
chicken(420611) family with sequence similarity 126, member A
sheep(101108827) family with sequence similarity 126, member A
domestic guinea pig(100730815) family with sequence similarity 126, member A
naked mole-rat(101699160) family with sequence similarity 126, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032581 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055301 MISSION® esiRNA esiRNA human FAM126A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032581 Rosetta Predictions human pricing
XM_001061478 Rosetta Predictions rat pricing
XM_575330 Rosetta Predictions rat pricing
NM_053090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122558 predicted 1762
2 SASI_Hs01_00122559 predicted 1785
3 SASI_Hs01_00122560 predicted 622
4 SASI_Hs01_00122561 predicted 374
5 SASI_Hs01_00122562 predicted 932
6 SASI_Hs01_00122563 predicted 1490
7 SASI_Hs02_00360112 predicted 862
8 SASI_Hs01_00122564 predicted 1316
9 SASI_Hs01_00122565 predicted 259
10 SASI_Hs02_00360113 predicted 636
11 SASI_Hs01_00122566 predicted 947
12 SASI_Hs01_00122567 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300244 predicted 1180
2 SASI_Rn02_00300245 predicted 1430
3 SASI_Rn02_00300246 predicted 941
4 SASI_Rn02_00300247 predicted 303
5 SASI_Rn02_00300248 predicted 1314
6 SASI_Rn02_00300249 predicted 615
7 SASI_Rn02_00300250 predicted 1322
8 SASI_Rn02_00300251 predicted 572
9 SASI_Rn02_00300252 predicted 632
10 SASI_Rn02_00300253 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403498 predicted 297
2 SASI_Rn02_00403499 predicted 327
3 SASI_Rn02_00403500 predicted 259
4 SASI_Rn02_00403501 predicted 473
5 SASI_Rn02_00403502 predicted 316
6 SASI_Rn02_00403503 predicted 439
7 SASI_Rn02_00403504 predicted 256
8 SASI_Rn02_00403505 predicted 287
9 SASI_Rn02_00403506 predicted 376
10 SASI_Rn02_00403507 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058760 predicted 838
2 SASI_Mm01_00058761 predicted 1102
3 SASI_Mm01_00058763 predicted 618
4 SASI_Mm01_00058764 predicted 296
5 SASI_Mm02_00337585 predicted 1335
6 SASI_Mm01_00058768 predicted 1313
7 SASI_Mm01_00058765 predicted 1171
8 SASI_Mm01_00058766 predicted 1556
9 SASI_Mm02_00337586 predicted 754
10 SASI_Mm01_00058767 predicted 918
11 SASI_Mm01_00058762 predicted 2352
12 SASI_Mm01_00058769 predicted 2518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053090
VALIDATED
FAM126A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 126, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-572s21c1
Sequence:CCGGAGTTGACAAACACGGACATAGCTCGAGCTATGTCCGTGTTTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.2-1656s1c1
Sequence:CCGGGGAGCAGATGCCAATAGATTTCTCGAGAAATCTATTGGCATCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1756s21c1
Sequence:CCGGAGCAGGGACCTCCTAGTATTACTCGAGTAATACTAGGAGGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-2054s21c1
Sequence:CCGGACGTCCTCAGTGAGGTTATTTCTCGAGAAATAACCTCACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1656s21c1
Sequence:CCGGGGAGCAGATGCCAATAGATTTCTCGAGAAATCTATTGGCATCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1569s21c1
Sequence:CCGGGCGGCCACTGTATTTAGTAAACTCGAGTTTACTAAATACAGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053090.1-4580s1c1
Sequence:CCGGGCCACCATATTGAAACCTCATCTCGAGATGAGGTTTCAATATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.1-2703s1c1
Sequence:CCGGGCCTGTAGTCTCCAAGAAGAACTCGAGTTCTTCTTGGAGACTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.1-1811s1c1
Sequence:CCGGGCTGTGTTACAATGCTGCCTTCTCGAGAAGGCAGCATTGTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053090
VALIDATED
FAM126A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 126, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-572s21c1
Sequence:CCGGAGTTGACAAACACGGACATAGCTCGAGCTATGTCCGTGTTTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.2-1656s1c1
Sequence:CCGGGGAGCAGATGCCAATAGATTTCTCGAGAAATCTATTGGCATCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1756s21c1
Sequence:CCGGAGCAGGGACCTCCTAGTATTACTCGAGTAATACTAGGAGGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-2054s21c1
Sequence:CCGGACGTCCTCAGTGAGGTTATTTCTCGAGAAATAACCTCACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1656s21c1
Sequence:CCGGGGAGCAGATGCCAATAGATTTCTCGAGAAATCTATTGGCATCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1569s21c1
Sequence:CCGGGCGGCCACTGTATTTAGTAAACTCGAGTTTACTAAATACAGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053090.1-4580s1c1
Sequence:CCGGGCCACCATATTGAAACCTCATCTCGAGATGAGGTTTCAATATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.1-2703s1c1
Sequence:CCGGGCCTGTAGTCTCCAAGAAGAACTCGAGTTCTTCTTGGAGACTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.1-1811s1c1
Sequence:CCGGGCTGTGTTACAATGCTGCCTTCTCGAGAAGGCAGCATTGTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053090
VALIDATED
FAM126A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 126, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-572s21c1
Sequence:CCGGAGTTGACAAACACGGACATAGCTCGAGCTATGTCCGTGTTTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.2-1656s1c1
Sequence:CCGGGGAGCAGATGCCAATAGATTTCTCGAGAAATCTATTGGCATCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1756s21c1
Sequence:CCGGAGCAGGGACCTCCTAGTATTACTCGAGTAATACTAGGAGGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-2054s21c1
Sequence:CCGGACGTCCTCAGTGAGGTTATTTCTCGAGAAATAACCTCACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1656s21c1
Sequence:CCGGGGAGCAGATGCCAATAGATTTCTCGAGAAATCTATTGGCATCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_053090.2-1569s21c1
Sequence:CCGGGCGGCCACTGTATTTAGTAAACTCGAGTTTACTAAATACAGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053090.1-4580s1c1
Sequence:CCGGGCCACCATATTGAAACCTCATCTCGAGATGAGGTTTCAATATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.1-2703s1c1
Sequence:CCGGGCCTGTAGTCTCCAAGAAGAACTCGAGTTCTTCTTGGAGACTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053090.1-1811s1c1
Sequence:CCGGGCTGTGTTACAATGCTGCCTTCTCGAGAAGGCAGCATTGTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032581
VALIDATED
FAM126A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 126, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-446s1c1
Sequence:CCGGGCTTCAATTTACGCTGCAATTCTCGAGAATTGCAGCGTAAATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032581.2-1032s1c1
Sequence:CCGGGCCCAGCTAGAATTATATCCACTCGAGTGGATATAATTCTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032581.2-1762s1c1
Sequence:CCGGGACCTCCTAGTATTAGCATTACTCGAGTAATGCTAATACTAGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032581.2-1435s1c1
Sequence:CCGGGCAAAGATCACTTTGCTCGAACTCGAGTTCGAGCAAAGTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-375s1c1
Sequence:CCGGCCACAAAGTGAGTTGCTAGAACTCGAGTTCTAGCAACTCACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032581.2-1728s1c1
Sequence:CCGGGAACTTCCAATGAAGCATCAACTCGAGTTGATGCTTCATTGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-793s1c1
Sequence:CCGGGTTACAATGCTGCCTTAACTTCTCGAGAAGTTAAGGCAGCATTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032581
VALIDATED
FAM126A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 126, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-446s1c1
Sequence:CCGGGCTTCAATTTACGCTGCAATTCTCGAGAATTGCAGCGTAAATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032581.2-1032s1c1
Sequence:CCGGGCCCAGCTAGAATTATATCCACTCGAGTGGATATAATTCTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032581.2-1762s1c1
Sequence:CCGGGACCTCCTAGTATTAGCATTACTCGAGTAATGCTAATACTAGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032581.2-1435s1c1
Sequence:CCGGGCAAAGATCACTTTGCTCGAACTCGAGTTCGAGCAAAGTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-375s1c1
Sequence:CCGGCCACAAAGTGAGTTGCTAGAACTCGAGTTCTAGCAACTCACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032581.2-1728s1c1
Sequence:CCGGGAACTTCCAATGAAGCATCAACTCGAGTTGATGCTTCATTGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-793s1c1
Sequence:CCGGGTTACAATGCTGCCTTAACTTCTCGAGAAGTTAAGGCAGCATTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032581
VALIDATED
FAM126A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 126, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-446s1c1
Sequence:CCGGGCTTCAATTTACGCTGCAATTCTCGAGAATTGCAGCGTAAATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032581.2-1032s1c1
Sequence:CCGGGCCCAGCTAGAATTATATCCACTCGAGTGGATATAATTCTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032581.2-1762s1c1
Sequence:CCGGGACCTCCTAGTATTAGCATTACTCGAGTAATGCTAATACTAGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032581.2-1435s1c1
Sequence:CCGGGCAAAGATCACTTTGCTCGAACTCGAGTTCGAGCAAAGTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-375s1c1
Sequence:CCGGCCACAAAGTGAGTTGCTAGAACTCGAGTTCTAGCAACTCACTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032581.2-1728s1c1
Sequence:CCGGGAACTTCCAATGAAGCATCAACTCGAGTTGATGCTTCATTGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032581.2-793s1c1
Sequence:CCGGGTTACAATGCTGCCTTAACTTCTCGAGAAGTTAAGGCAGCATTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks