EMAIL THIS PAGE TO A FRIEND

FAM126B

family with sequence similarity 126, member B

208 Gene Product Result for
Synonyms: HYCC2
UniProtKB ID: Q8IXS8, B2RCG7, Q4ZG87, Q53TX6
Gene ID:
Mouse(213056) family with sequence similarity 126, member B
Rat(316415) family with sequence similarity 126, member B
naked mole-rat(101716396) family with sequence similarity 126, member B
domestic guinea pig(100713614) family with sequence similarity 126, member B
sheep(101106405) family with sequence similarity 126, member B
chicken(429010) family with sequence similarity 126, member B
dog(488469) family with sequence similarity 126, member B
cow(533324) family with sequence similarity 126, member B
domestic cat(101093128) family with sequence similarity 126, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173822 Rosetta Predictions human pricing
NM_001025710 Rosetta Predictions rat pricing
NM_172513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112353 predicted 740
2 SASI_Hs01_00112354 predicted 1757
3 SASI_Hs01_00112355 predicted 886
4 SASI_Hs01_00112356 predicted 1605
5 SASI_Hs02_00368682 predicted 917
6 SASI_Hs01_00112357 predicted 853
7 SASI_Hs01_00112358 predicted 1043
8 SASI_Hs01_00112359 predicted 1834
9 SASI_Hs01_00112360 predicted 876
10 SASI_Hs01_00112361 predicted 1626
11 SASI_Hs01_00112362 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097212 predicted 941
2 SASI_Rn01_00097213 predicted 1460
3 SASI_Rn02_00203332 predicted 1677
4 SASI_Rn01_00097214 predicted 337
5 SASI_Rn01_00097215 predicted 1529
6 SASI_Rn01_00097216 predicted 1652
7 SASI_Rn01_00097217 predicted 1063
8 SASI_Rn01_00097219 predicted 875
9 SASI_Rn01_00097220 predicted 688
10 SASI_Rn02_00203333 predicted 769
11 SASI_Rn01_00097211 predicted 1170
12 SASI_Rn01_00097218 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027017 predicted 803
2 SASI_Mm01_00027018 predicted 1498
3 SASI_Mm01_00027019 predicted 1818
4 SASI_Mm01_00027020 predicted 1687
5 SASI_Mm02_00344110 predicted 970
6 SASI_Mm01_00027022 predicted 657
7 SASI_Mm01_00027024 predicted 482
8 SASI_Mm02_00344111 predicted 938
9 SASI_Mm01_00027025 predicted 700
10 SASI_Mm02_00344112 predicted 1444
11 SASI_Mm01_00027021 predicted 855
12 SASI_Mm01_00027023 predicted 629
13 SASI_Mm01_00027026 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173822
VALIDATED
FAM126B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 126, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173822.1-2453s1c1
Sequence:CCGGGCAGGACTCTTGATTGTGTAACTCGAGTTACACAATCAAGAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173822.1-528s1c1
Sequence:CCGGGCTGATAAAGATGGGAACAATCTCGAGATTGTTCCCATCTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_173822.1-2389s1c1
Sequence:CCGGCCGAAGACATAAATGTTCAATCTCGAGATTGAACATTTATGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173822.1-1760s1c1
Sequence:CCGGGCAGCTAATATCCCAGGTGTACTCGAGTACACCTGGGATATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-250s21c1
Sequence:CCGGACACTCAGATCACCAGTTATGCTCGAGCATAACTGGTGATCTGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1605s21c1
Sequence:CCGGACTGAGGGAGGTACTAATTTACTCGAGTAAATTAGTACCTCCCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-383s21c1
Sequence:CCGGTAGCTCAGAGGTTCGACTTAACTCGAGTTAAGTCGAACCTCTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1145s21c1
Sequence:CCGGAGCTTCAATCCGTCGTCATAGCTCGAGCTATGACGACGGATTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1506s21c1
Sequence:CCGGATCAATAGCTTAAGTCTAATCCTCGAGGATTAGACTTAAGCTATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173822
VALIDATED
FAM126B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 126, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173822.1-2453s1c1
Sequence:CCGGGCAGGACTCTTGATTGTGTAACTCGAGTTACACAATCAAGAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173822.1-528s1c1
Sequence:CCGGGCTGATAAAGATGGGAACAATCTCGAGATTGTTCCCATCTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_173822.1-2389s1c1
Sequence:CCGGCCGAAGACATAAATGTTCAATCTCGAGATTGAACATTTATGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173822.1-1760s1c1
Sequence:CCGGGCAGCTAATATCCCAGGTGTACTCGAGTACACCTGGGATATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-250s21c1
Sequence:CCGGACACTCAGATCACCAGTTATGCTCGAGCATAACTGGTGATCTGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1605s21c1
Sequence:CCGGACTGAGGGAGGTACTAATTTACTCGAGTAAATTAGTACCTCCCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-383s21c1
Sequence:CCGGTAGCTCAGAGGTTCGACTTAACTCGAGTTAAGTCGAACCTCTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1145s21c1
Sequence:CCGGAGCTTCAATCCGTCGTCATAGCTCGAGCTATGACGACGGATTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1506s21c1
Sequence:CCGGATCAATAGCTTAAGTCTAATCCTCGAGGATTAGACTTAAGCTATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173822
VALIDATED
FAM126B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 126, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173822.1-2453s1c1
Sequence:CCGGGCAGGACTCTTGATTGTGTAACTCGAGTTACACAATCAAGAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173822.1-528s1c1
Sequence:CCGGGCTGATAAAGATGGGAACAATCTCGAGATTGTTCCCATCTTTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_173822.1-2389s1c1
Sequence:CCGGCCGAAGACATAAATGTTCAATCTCGAGATTGAACATTTATGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173822.1-1760s1c1
Sequence:CCGGGCAGCTAATATCCCAGGTGTACTCGAGTACACCTGGGATATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-250s21c1
Sequence:CCGGACACTCAGATCACCAGTTATGCTCGAGCATAACTGGTGATCTGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1605s21c1
Sequence:CCGGACTGAGGGAGGTACTAATTTACTCGAGTAAATTAGTACCTCCCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-383s21c1
Sequence:CCGGTAGCTCAGAGGTTCGACTTAACTCGAGTTAAGTCGAACCTCTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1145s21c1
Sequence:CCGGAGCTTCAATCCGTCGTCATAGCTCGAGCTATGACGACGGATTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173822.3-1506s21c1
Sequence:CCGGATCAATAGCTTAAGTCTAATCCTCGAGGATTAGACTTAAGCTATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172513
VALIDATED
FAM126B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 126, member B
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172513.2-1503s1c1
Sequence:CCGGGCCAGTGCTTCCTCAAGTAAACTCGAGTTTACTTGAGGAAGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172513.2-747s1c1
Sequence:CCGGGCATCATCTTACCAATCTCTTCTCGAGAAGAGATTGGTAAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172513.2-2553s1c1
Sequence:CCGGCCCAGGAATGATTGATATTATCTCGAGATAATATCAATCATTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172513.2-686s1c1
Sequence:CCGGCCGGTTTGAAGTCCTAAGTTTCTCGAGAAACTTAGGACTTCAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172513.2-3043s1c1
Sequence:CCGGCCAGTAAACTAGATGTTGAATCTCGAGATTCAACATCTAGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1812s1c1
Sequence:CCGGGTTTCAATATGCAGCTAATATCTCGAGATATTAGCTGCATATTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1025s1c1
Sequence:CCGGGTACTTGATGACATCATTTACCTCGAGGTAAATGATGTCATCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1136s1c1
Sequence:CCGGGAAGGCCAGAAAGTACTTAAACTCGAGTTTAAGTACTTTCTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1700s1c1
Sequence:CCGGGCTAATCGATATTCAACTATCCTCGAGGATAGTTGAATATCGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-489s1c1
Sequence:CCGGCCGAATTGATTTGGGTTTATTCTCGAGAATAAACCCAAATCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-311s1c1
Sequence:CCGGGACACTCAGATTACCAGTTATCTCGAGATAACTGGTAATCTGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172513.3-2154s21c1
Sequence:CCGGTGTCGAGGAAATGGTGTATAACTCGAGTTATACACCATTTCCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-1568s21c1
Sequence:CCGGACCAATAGTCTGAGTCTAATCCTCGAGGATTAGACTCAGACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-715s21c1
Sequence:CCGGTGATCTCATCAGGGTTGTTTACTCGAGTAAACAACCCTGATGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-798s21c1
Sequence:CCGGTTCTCATGCTGTGCTATAATTCTCGAGAATTATAGCACAGCATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172513.3-445s21c1
Sequence:CCGGTAGCTCTGAAGTTCGACTTAACTCGAGTTAAGTCGAACTTCAGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172513
VALIDATED
FAM126B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 126, member B
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172513.2-1503s1c1
Sequence:CCGGGCCAGTGCTTCCTCAAGTAAACTCGAGTTTACTTGAGGAAGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172513.2-747s1c1
Sequence:CCGGGCATCATCTTACCAATCTCTTCTCGAGAAGAGATTGGTAAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172513.2-2553s1c1
Sequence:CCGGCCCAGGAATGATTGATATTATCTCGAGATAATATCAATCATTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172513.2-686s1c1
Sequence:CCGGCCGGTTTGAAGTCCTAAGTTTCTCGAGAAACTTAGGACTTCAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172513.2-3043s1c1
Sequence:CCGGCCAGTAAACTAGATGTTGAATCTCGAGATTCAACATCTAGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1812s1c1
Sequence:CCGGGTTTCAATATGCAGCTAATATCTCGAGATATTAGCTGCATATTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1025s1c1
Sequence:CCGGGTACTTGATGACATCATTTACCTCGAGGTAAATGATGTCATCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1136s1c1
Sequence:CCGGGAAGGCCAGAAAGTACTTAAACTCGAGTTTAAGTACTTTCTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1700s1c1
Sequence:CCGGGCTAATCGATATTCAACTATCCTCGAGGATAGTTGAATATCGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-489s1c1
Sequence:CCGGCCGAATTGATTTGGGTTTATTCTCGAGAATAAACCCAAATCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-311s1c1
Sequence:CCGGGACACTCAGATTACCAGTTATCTCGAGATAACTGGTAATCTGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172513.3-2154s21c1
Sequence:CCGGTGTCGAGGAAATGGTGTATAACTCGAGTTATACACCATTTCCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-1568s21c1
Sequence:CCGGACCAATAGTCTGAGTCTAATCCTCGAGGATTAGACTCAGACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-715s21c1
Sequence:CCGGTGATCTCATCAGGGTTGTTTACTCGAGTAAACAACCCTGATGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-798s21c1
Sequence:CCGGTTCTCATGCTGTGCTATAATTCTCGAGAATTATAGCACAGCATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172513.3-445s21c1
Sequence:CCGGTAGCTCTGAAGTTCGACTTAACTCGAGTTAAGTCGAACTTCAGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172513
VALIDATED
FAM126B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 126, member B
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172513.2-1503s1c1
Sequence:CCGGGCCAGTGCTTCCTCAAGTAAACTCGAGTTTACTTGAGGAAGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172513.2-747s1c1
Sequence:CCGGGCATCATCTTACCAATCTCTTCTCGAGAAGAGATTGGTAAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172513.2-2553s1c1
Sequence:CCGGCCCAGGAATGATTGATATTATCTCGAGATAATATCAATCATTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172513.2-686s1c1
Sequence:CCGGCCGGTTTGAAGTCCTAAGTTTCTCGAGAAACTTAGGACTTCAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172513.2-3043s1c1
Sequence:CCGGCCAGTAAACTAGATGTTGAATCTCGAGATTCAACATCTAGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1812s1c1
Sequence:CCGGGTTTCAATATGCAGCTAATATCTCGAGATATTAGCTGCATATTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1025s1c1
Sequence:CCGGGTACTTGATGACATCATTTACCTCGAGGTAAATGATGTCATCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1136s1c1
Sequence:CCGGGAAGGCCAGAAAGTACTTAAACTCGAGTTTAAGTACTTTCTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-1700s1c1
Sequence:CCGGGCTAATCGATATTCAACTATCCTCGAGGATAGTTGAATATCGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-489s1c1
Sequence:CCGGCCGAATTGATTTGGGTTTATTCTCGAGAATAAACCCAAATCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172513.3-311s1c1
Sequence:CCGGGACACTCAGATTACCAGTTATCTCGAGATAACTGGTAATCTGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172513.3-2154s21c1
Sequence:CCGGTGTCGAGGAAATGGTGTATAACTCGAGTTATACACCATTTCCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-1568s21c1
Sequence:CCGGACCAATAGTCTGAGTCTAATCCTCGAGGATTAGACTCAGACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-715s21c1
Sequence:CCGGTGATCTCATCAGGGTTGTTTACTCGAGTAAACAACCCTGATGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172513.3-798s21c1
Sequence:CCGGTTCTCATGCTGTGCTATAATTCTCGAGAATTATAGCACAGCATGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172513.3-445s21c1
Sequence:CCGGTAGCTCTGAAGTTCGACTTAACTCGAGTTAAGTCGAACTTCAGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks