EMAIL THIS PAGE TO A FRIEND

FAM127A

family with sequence similarity 127, member A

87 Gene Product Result for
Synonyms: CXX1 MAR8C MART8C Mar8 Mart8
Species: Human FAM127A(8933)
UniProtKB ID: O15255, Q6IBF1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001078171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001078171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001078171 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003928 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159381 MISSION® esiRNA esiRNA human FAM127A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078171 Rosetta Predictions human pricing
NM_003928 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313280 predicted 1008
2 SASI_Hs02_00313281 predicted 1153
3 SASI_Hs02_00313282 predicted 1089
4 SASI_Hs02_00313283 predicted 1176
5 SASI_Hs02_00313284 predicted 1007
6 SASI_Hs02_00313285 predicted 1100
7 SASI_Hs02_00313286 predicted 1096
8 SASI_Hs02_00313287 predicted 1113
9 SASI_Hs02_00313288 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080084 predicted 940
2 SASI_Hs01_00080085 predicted 949
3 SASI_Hs01_00080086 predicted 956
4 SASI_Hs01_00080087 predicted 892
5 SASI_Hs01_00080088 predicted 1103
6 SASI_Hs01_00080089 predicted 1038
7 SASI_Hs01_00080090 predicted 1031
8 SASI_Hs01_00080091 predicted 1116
9 SASI_Hs01_00080092 predicted 1050
10 SASI_Hs01_00080093 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001078171
VALIDATED
FAM127A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 127, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-801s21c1
Sequence:CCGGGACTACATCATTCTGCCCACACTCGAGTGTGGGCAGAATGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078171.1-973s21c1
Sequence:CCGGCTTCAGCGAGACCTATTTCCTCTCGAGAGGAAATAGGTCTCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078171.1-377s21c1
Sequence:CCGGCCGAGATGAAGCGAGTCTTTGCTCGAGCAAAGACTCGCTTCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-574s21c1
Sequence:CCGGGTAGTGCTTGCCTTTGTTCCACTCGAGTGGAACAAAGGCAAGCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-1045s21c1
Sequence:CCGGCAGCCAAATCGAGTCTCTCATCTCGAGATGAGAGACTCGATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001078171
VALIDATED
FAM127A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 127, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-801s21c1
Sequence:CCGGGACTACATCATTCTGCCCACACTCGAGTGTGGGCAGAATGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078171.1-973s21c1
Sequence:CCGGCTTCAGCGAGACCTATTTCCTCTCGAGAGGAAATAGGTCTCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078171.1-377s21c1
Sequence:CCGGCCGAGATGAAGCGAGTCTTTGCTCGAGCAAAGACTCGCTTCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-574s21c1
Sequence:CCGGGTAGTGCTTGCCTTTGTTCCACTCGAGTGGAACAAAGGCAAGCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-1045s21c1
Sequence:CCGGCAGCCAAATCGAGTCTCTCATCTCGAGATGAGAGACTCGATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001078171
VALIDATED
FAM127A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 127, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-801s21c1
Sequence:CCGGGACTACATCATTCTGCCCACACTCGAGTGTGGGCAGAATGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078171.1-973s21c1
Sequence:CCGGCTTCAGCGAGACCTATTTCCTCTCGAGAGGAAATAGGTCTCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078171.1-377s21c1
Sequence:CCGGCCGAGATGAAGCGAGTCTTTGCTCGAGCAAAGACTCGCTTCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-574s21c1
Sequence:CCGGGTAGTGCTTGCCTTTGTTCCACTCGAGTGGAACAAAGGCAAGCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078171.1-1045s21c1
Sequence:CCGGCAGCCAAATCGAGTCTCTCATCTCGAGATGAGAGACTCGATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003928
VALIDATED
FAM127A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 127, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003928.1-618s1c1
Sequence:CCGGCCATGTACATTTGGACGCTGTCTCGAGACAGCGTCCAAATGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-909s1c1
Sequence:CCGGCTTCAGCGAGACCTATTTCCTCTCGAGAGGAAATAGGTCTCGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1058s1c1
Sequence:CCGGGTCTCTCTGATGTGTGCCTTTCTCGAGAAAGGCACACATCAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-510s1c1
Sequence:CCGGGTAGTGCTTGCCTTTGTTCCACTCGAGTGGAACAAAGGCAAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-737s1c1
Sequence:CCGGGACTACATCATTCTGCCCACACTCGAGTGTGGGCAGAATGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-981s1c1
Sequence:CCGGCAGCCAAATCGAGTCTCTCATCTCGAGATGAGAGACTCGATTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1035s1c1
Sequence:CCGGCGCAGTATTCTGAGTTTGCAACTCGAGTTGCAAACTCAGAATACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-938s1c1
Sequence:CCGGCCAGAAACCTCTTGTGTTCTTCTCGAGAAGAACACAAGAGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1030s1c1
Sequence:CCGGCATAACGCAGTATTCTGAGTTCTCGAGAACTCAGAATACTGCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003928
VALIDATED
FAM127A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 127, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003928.1-618s1c1
Sequence:CCGGCCATGTACATTTGGACGCTGTCTCGAGACAGCGTCCAAATGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-909s1c1
Sequence:CCGGCTTCAGCGAGACCTATTTCCTCTCGAGAGGAAATAGGTCTCGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1058s1c1
Sequence:CCGGGTCTCTCTGATGTGTGCCTTTCTCGAGAAAGGCACACATCAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-510s1c1
Sequence:CCGGGTAGTGCTTGCCTTTGTTCCACTCGAGTGGAACAAAGGCAAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-737s1c1
Sequence:CCGGGACTACATCATTCTGCCCACACTCGAGTGTGGGCAGAATGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-981s1c1
Sequence:CCGGCAGCCAAATCGAGTCTCTCATCTCGAGATGAGAGACTCGATTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1035s1c1
Sequence:CCGGCGCAGTATTCTGAGTTTGCAACTCGAGTTGCAAACTCAGAATACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-938s1c1
Sequence:CCGGCCAGAAACCTCTTGTGTTCTTCTCGAGAAGAACACAAGAGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1030s1c1
Sequence:CCGGCATAACGCAGTATTCTGAGTTCTCGAGAACTCAGAATACTGCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003928
VALIDATED
FAM127A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 127, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003928.1-618s1c1
Sequence:CCGGCCATGTACATTTGGACGCTGTCTCGAGACAGCGTCCAAATGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-909s1c1
Sequence:CCGGCTTCAGCGAGACCTATTTCCTCTCGAGAGGAAATAGGTCTCGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1058s1c1
Sequence:CCGGGTCTCTCTGATGTGTGCCTTTCTCGAGAAAGGCACACATCAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-510s1c1
Sequence:CCGGGTAGTGCTTGCCTTTGTTCCACTCGAGTGGAACAAAGGCAAGCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-737s1c1
Sequence:CCGGGACTACATCATTCTGCCCACACTCGAGTGTGGGCAGAATGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-981s1c1
Sequence:CCGGCAGCCAAATCGAGTCTCTCATCTCGAGATGAGAGACTCGATTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1035s1c1
Sequence:CCGGCGCAGTATTCTGAGTTTGCAACTCGAGTTGCAAACTCAGAATACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003928.1-938s1c1
Sequence:CCGGCCAGAAACCTCTTGTGTTCTTCTCGAGAAGAACACAAGAGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003928.1-1030s1c1
Sequence:CCGGCATAACGCAGTATTCTGAGTTCTCGAGAACTCAGAATACTGCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks