EMAIL THIS PAGE TO A FRIEND

FAM127B

family with sequence similarity 127, member B

Synonyms: CXX1b MAR8A
Species: Human FAM127B(26071)
UniProtKB ID: Q9BWD3, A2A2V9, Q8TBU2
Gene ID:
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301530 ANTI-F127B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001078172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001078172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001078172 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102751 MISSION® esiRNA esiRNA human FAM127B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078172 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313289 predicted 868
2 SASI_Hs02_00313290 predicted 851
3 SASI_Hs02_00313291 predicted 787
4 SASI_Hs02_00313292 predicted 895
5 SASI_Hs02_00313293 predicted 789
6 SASI_Hs02_00313294 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001078172
VALIDATED
FAM127B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 127, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-868s21c1
Sequence:CCGGAGACTGTGGCTCCTAGTGATGCTCGAGCATCACTAGGAGCCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1027s21c1
Sequence:CCGGACATAGCTGCCAGGGCTTAAGCTCGAGCTTAAGCCCTGGCAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1050s21c1
Sequence:CCGGTGCCTGGCAACCAAATCGAATCTCGAGATTCGATTTGGTTGCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078172.1-848s21c1
Sequence:CCGGATCCACCGCATCTCACCAACACTCGAGTGTTGGTGAGATGCGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1012s21c1
Sequence:CCGGTCTTGTGTTCCTGCCACATAGCTCGAGCTATGTGGCAGGAACACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001078172
VALIDATED
FAM127B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 127, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-868s21c1
Sequence:CCGGAGACTGTGGCTCCTAGTGATGCTCGAGCATCACTAGGAGCCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1027s21c1
Sequence:CCGGACATAGCTGCCAGGGCTTAAGCTCGAGCTTAAGCCCTGGCAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1050s21c1
Sequence:CCGGTGCCTGGCAACCAAATCGAATCTCGAGATTCGATTTGGTTGCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078172.1-848s21c1
Sequence:CCGGATCCACCGCATCTCACCAACACTCGAGTGTTGGTGAGATGCGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1012s21c1
Sequence:CCGGTCTTGTGTTCCTGCCACATAGCTCGAGCTATGTGGCAGGAACACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001078172
VALIDATED
FAM127B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 127, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-868s21c1
Sequence:CCGGAGACTGTGGCTCCTAGTGATGCTCGAGCATCACTAGGAGCCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1027s21c1
Sequence:CCGGACATAGCTGCCAGGGCTTAAGCTCGAGCTTAAGCCCTGGCAGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1050s21c1
Sequence:CCGGTGCCTGGCAACCAAATCGAATCTCGAGATTCGATTTGGTTGCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078172.1-848s21c1
Sequence:CCGGATCCACCGCATCTCACCAACACTCGAGTGTTGGTGAGATGCGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001078172.1-1012s21c1
Sequence:CCGGTCTTGTGTTCCTGCCACATAGCTCGAGCTATGTGGCAGGAACACAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks