EMAIL THIS PAGE TO A FRIEND

FAM127C

family with sequence similarity 127, member C

146 Gene Product Result for
Synonyms: CXX1c MAR8B
UniProtKB ID: Q17RB0
Gene ID:
cow(511516) family with sequence similarity 127, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001078173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001078173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001078173 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102581 MISSION® esiRNA esiRNA human FAM127C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078173 Rosetta Predictions human pricing
XM_497160 Rosetta Predictions human pricing
XM_931980 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313295 predicted 861
2 SASI_Hs02_00313296 predicted 721
3 SASI_Hs02_00313297 predicted 708
4 SASI_Hs02_00313298 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263418 predicted 855
2 SASI_Hs01_00263419 predicted 718
3 SASI_Hs01_00263420 predicted 704
4 SASI_Hs01_00263421 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299348 predicted 855
2 SASI_Hs01_00299349 predicted 714
3 SASI_Hs01_00299350 predicted 707
4 SASI_Hs01_00299351 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001078173
FAM127C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 127, member C
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-167s21c1
Sequence:CCGGCGAGACGTTTGATGGCGATACCTCGAGGTATCGCCATCAAACGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-144s21c1
Sequence:CCGGTGGAGGAACCCGATTCCCTTTCTCGAGAAAGGGAATCGGGTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-232s21c1
Sequence:CCGGTCGTGGACGAGAACACGTTCTCTCGAGAGAACGTGTTCTCGTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078173.1-1451s21c1
Sequence:CCGGTCTAAACCAGTTAGGATTATCCTCGAGGATAATCCTAACTGGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001078173
FAM127C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 127, member C
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-167s21c1
Sequence:CCGGCGAGACGTTTGATGGCGATACCTCGAGGTATCGCCATCAAACGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-144s21c1
Sequence:CCGGTGGAGGAACCCGATTCCCTTTCTCGAGAAAGGGAATCGGGTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-232s21c1
Sequence:CCGGTCGTGGACGAGAACACGTTCTCTCGAGAGAACGTGTTCTCGTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078173.1-1451s21c1
Sequence:CCGGTCTAAACCAGTTAGGATTATCCTCGAGGATAATCCTAACTGGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001078173
FAM127C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 127, member C
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-167s21c1
Sequence:CCGGCGAGACGTTTGATGGCGATACCTCGAGGTATCGCCATCAAACGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-144s21c1
Sequence:CCGGTGGAGGAACCCGATTCCCTTTCTCGAGAAAGGGAATCGGGTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078173.1-232s21c1
Sequence:CCGGTCGTGGACGAGAACACGTTCTCTCGAGAGAACGTGTTCTCGTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001078173.1-1451s21c1
Sequence:CCGGTCTAAACCAGTTAGGATTATCCTCGAGGATAATCCTAACTGGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks