EMAIL THIS PAGE TO A FRIEND

FAM129A

family with sequence similarity 129, member A

168 Gene Product Result for
Synonyms: C1orf24 NIBAN
Gene ID:
Mouse(63913) family with sequence similarity 129, member A
Rat(63912) family with sequence similarity 129, member A
chicken(424451) family with sequence similarity 129, member A
dog(480041) family with sequence similarity 129, member A
domestic cat(101086940) family with sequence similarity 129, member A
cow(614787) family with sequence similarity 129, member A
sheep(101122713) family with sequence similarity 129, member A
domestic guinea pig(100731219) family with sequence similarity 129, member A
naked mole-rat(101709450) family with sequence similarity 129, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052966 Rosetta Predictions human pricing
NM_022242 Rosetta Predictions rat pricing
NM_022018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117858 predicted 1133
2 SASI_Hs01_00117859 predicted 1140
3 SASI_Hs01_00117860 predicted 1923
4 SASI_Hs01_00117862 predicted 1531
5 SASI_Hs02_00361779 predicted 1668
6 SASI_Hs01_00117863 predicted 315
7 SASI_Hs01_00117864 predicted 1787
8 SASI_Hs01_00117865 predicted 2038
9 SASI_Hs01_00117866 predicted 1294
10 SASI_Hs01_00117867 predicted 1778
11 SASI_Hs01_00117861 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044468 predicted 861
2 SASI_Rn01_00044469 predicted 2793
3 SASI_Rn01_00044470 predicted 1303
4 SASI_Rn01_00044471 predicted 970
5 SASI_Rn01_00044473 predicted 2729
6 SASI_Rn01_00044474 predicted 1458
7 SASI_Rn02_00263016 predicted 695
8 SASI_Rn01_00044475 predicted 1732
9 SASI_Rn01_00044476 predicted 2739
10 SASI_Rn01_00044477 predicted 1623
11 SASI_Rn01_00044472 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138790 predicted 827
2 SASI_Mm01_00138791 predicted 1420
3 SASI_Mm01_00138792 predicted 1585
4 SASI_Mm01_00138793 predicted 2707
5 SASI_Mm01_00138795 predicted 2655
6 SASI_Mm01_00138796 predicted 784
7 SASI_Mm02_00326492 predicted 1683
8 SASI_Mm01_00138797 predicted 830
9 SASI_Mm01_00138798 predicted 607
10 SASI_Mm01_00138799 predicted 1782
11 SASI_Mm01_00138794 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022018
VALIDATED
FAM129A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 129, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-1597s21c1
Sequence:CCGGTCCACGTTGAGAACGTCTATGCTCGAGCATAGACGTTCTCAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-817s21c1
Sequence:CCGGTCCTGGAGGAAGCCTACAATCCTCGAGGATTGTAGGCTTCCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.2-2717s1c1
Sequence:CCGGCATCCTAGCCGTACATGATTTCTCGAGAAATCATGTACGGCTAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022018.2-2967s1c1
Sequence:CCGGCCCTATGAATGATCGCTTTAGCTCGAGCTAAAGCGATCATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-2966s21c1
Sequence:CCGGTCCCTATGAATGATCGCTTTACTCGAGTAAAGCGATCATTCATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-1209s21c1
Sequence:CCGGATGGAGCCTTGCTATACTAAACTCGAGTTTAGTATAGCAAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-848s21c1
Sequence:CCGGCCAAGTTTCAGAAGGATTAAACTCGAGTTTAATCCTTCTGAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.1-846s1c1
Sequence:CCGGGCACCAAGTTTCAGAAGGATTCTCGAGAATCCTTCTGAAACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.1-1426s1c1
Sequence:CCGGCTCCGTGTCTTAAAGCAATATCTCGAGATATTGCTTTAAGACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022018
VALIDATED
FAM129A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 129, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-1597s21c1
Sequence:CCGGTCCACGTTGAGAACGTCTATGCTCGAGCATAGACGTTCTCAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-817s21c1
Sequence:CCGGTCCTGGAGGAAGCCTACAATCCTCGAGGATTGTAGGCTTCCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.2-2717s1c1
Sequence:CCGGCATCCTAGCCGTACATGATTTCTCGAGAAATCATGTACGGCTAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022018.2-2967s1c1
Sequence:CCGGCCCTATGAATGATCGCTTTAGCTCGAGCTAAAGCGATCATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-2966s21c1
Sequence:CCGGTCCCTATGAATGATCGCTTTACTCGAGTAAAGCGATCATTCATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-1209s21c1
Sequence:CCGGATGGAGCCTTGCTATACTAAACTCGAGTTTAGTATAGCAAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-848s21c1
Sequence:CCGGCCAAGTTTCAGAAGGATTAAACTCGAGTTTAATCCTTCTGAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.1-846s1c1
Sequence:CCGGGCACCAAGTTTCAGAAGGATTCTCGAGAATCCTTCTGAAACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.1-1426s1c1
Sequence:CCGGCTCCGTGTCTTAAAGCAATATCTCGAGATATTGCTTTAAGACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022018
VALIDATED
FAM129A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 129, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-1597s21c1
Sequence:CCGGTCCACGTTGAGAACGTCTATGCTCGAGCATAGACGTTCTCAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-817s21c1
Sequence:CCGGTCCTGGAGGAAGCCTACAATCCTCGAGGATTGTAGGCTTCCTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.2-2717s1c1
Sequence:CCGGCATCCTAGCCGTACATGATTTCTCGAGAAATCATGTACGGCTAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022018.2-2967s1c1
Sequence:CCGGCCCTATGAATGATCGCTTTAGCTCGAGCTAAAGCGATCATTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-2966s21c1
Sequence:CCGGTCCCTATGAATGATCGCTTTACTCGAGTAAAGCGATCATTCATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-1209s21c1
Sequence:CCGGATGGAGCCTTGCTATACTAAACTCGAGTTTAGTATAGCAAGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022018.2-848s21c1
Sequence:CCGGCCAAGTTTCAGAAGGATTAAACTCGAGTTTAATCCTTCTGAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.1-846s1c1
Sequence:CCGGGCACCAAGTTTCAGAAGGATTCTCGAGAATCCTTCTGAAACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022018.1-1426s1c1
Sequence:CCGGCTCCGTGTCTTAAAGCAATATCTCGAGATATTGCTTTAAGACACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052966
VALIDATED
FAM129A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 129, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-6417s1c1
Sequence:CCGGGCCTTGCATTACACATAGTAACTCGAGTTACTATGTGTAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1751s1c1
Sequence:CCGGGCTTCAGAAATACGAGCAGTTCTCGAGAACTGCTCGTATTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1036s1c1
Sequence:CCGGCCCTGGTTCAGCATCAAGTTTCTCGAGAAACTTGATGCTGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052966.1-4502s1c1
Sequence:CCGGCGTCCCAAGTAGCTGGAATTACTCGAGTAATTCCAGCTACTTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-2838s1c1
Sequence:CCGGGAGATCAAGGTAGCCCGTATTCTCGAGAATACGGGCTACCTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-2906s1c1
Sequence:CCGGGCTGTCACACAAAGATGACGTCTCGAGACGTCATCTTTGTGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-807s1c1
Sequence:CCGGCAGATGACATTTGAAGCCCAACTCGAGTTGGGCTTCAAATGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1122s1c1
Sequence:CCGGCGTTCTGACATGGATCAGATTCTCGAGAATCTGATCCATGTCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1616s1c1
Sequence:CCGGGAAGGTTAAACTCCGAGTCTTCTCGAGAAGACTCGGAGTTTAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-4340s1c1
Sequence:CCGGCCCAAGTATTACATCGTGGTTCTCGAGAACCACGATGTAATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-3777s1c1
Sequence:CCGGCCCGTCAATTAAACAAACATTCTCGAGAATGTTTGTTTAATTGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_052966.1-1789s1c1
Sequence:CCGGCCAATATGATTCACGTTGAAACTCGAGTTTCAACGTGAATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052966.1-1046s1c1
Sequence:CCGGGCATCAAGTTTCAGAAGGATTCTCGAGAATCCTTCTGAAACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052966
VALIDATED
FAM129A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 129, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-6417s1c1
Sequence:CCGGGCCTTGCATTACACATAGTAACTCGAGTTACTATGTGTAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1751s1c1
Sequence:CCGGGCTTCAGAAATACGAGCAGTTCTCGAGAACTGCTCGTATTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1036s1c1
Sequence:CCGGCCCTGGTTCAGCATCAAGTTTCTCGAGAAACTTGATGCTGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052966.1-4502s1c1
Sequence:CCGGCGTCCCAAGTAGCTGGAATTACTCGAGTAATTCCAGCTACTTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-2838s1c1
Sequence:CCGGGAGATCAAGGTAGCCCGTATTCTCGAGAATACGGGCTACCTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-2906s1c1
Sequence:CCGGGCTGTCACACAAAGATGACGTCTCGAGACGTCATCTTTGTGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-807s1c1
Sequence:CCGGCAGATGACATTTGAAGCCCAACTCGAGTTGGGCTTCAAATGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1122s1c1
Sequence:CCGGCGTTCTGACATGGATCAGATTCTCGAGAATCTGATCCATGTCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1616s1c1
Sequence:CCGGGAAGGTTAAACTCCGAGTCTTCTCGAGAAGACTCGGAGTTTAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-4340s1c1
Sequence:CCGGCCCAAGTATTACATCGTGGTTCTCGAGAACCACGATGTAATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-3777s1c1
Sequence:CCGGCCCGTCAATTAAACAAACATTCTCGAGAATGTTTGTTTAATTGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_052966.1-1789s1c1
Sequence:CCGGCCAATATGATTCACGTTGAAACTCGAGTTTCAACGTGAATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052966.1-1046s1c1
Sequence:CCGGGCATCAAGTTTCAGAAGGATTCTCGAGAATCCTTCTGAAACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052966
VALIDATED
FAM129A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 129, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-6417s1c1
Sequence:CCGGGCCTTGCATTACACATAGTAACTCGAGTTACTATGTGTAATGCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1751s1c1
Sequence:CCGGGCTTCAGAAATACGAGCAGTTCTCGAGAACTGCTCGTATTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1036s1c1
Sequence:CCGGCCCTGGTTCAGCATCAAGTTTCTCGAGAAACTTGATGCTGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052966.1-4502s1c1
Sequence:CCGGCGTCCCAAGTAGCTGGAATTACTCGAGTAATTCCAGCTACTTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-2838s1c1
Sequence:CCGGGAGATCAAGGTAGCCCGTATTCTCGAGAATACGGGCTACCTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-2906s1c1
Sequence:CCGGGCTGTCACACAAAGATGACGTCTCGAGACGTCATCTTTGTGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-807s1c1
Sequence:CCGGCAGATGACATTTGAAGCCCAACTCGAGTTGGGCTTCAAATGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1122s1c1
Sequence:CCGGCGTTCTGACATGGATCAGATTCTCGAGAATCTGATCCATGTCAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052966.1-1616s1c1
Sequence:CCGGGAAGGTTAAACTCCGAGTCTTCTCGAGAAGACTCGGAGTTTAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-4340s1c1
Sequence:CCGGCCCAAGTATTACATCGTGGTTCTCGAGAACCACGATGTAATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052966.1-3777s1c1
Sequence:CCGGCCCGTCAATTAAACAAACATTCTCGAGAATGTTTGTTTAATTGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_052966.1-1789s1c1
Sequence:CCGGCCAATATGATTCACGTTGAAACTCGAGTTTCAACGTGAATCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052966.1-1046s1c1
Sequence:CCGGGCATCAAGTTTCAGAAGGATTCTCGAGAATCCTTCTGAAACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks