EMAIL THIS PAGE TO A FRIEND

FAM129B

family with sequence similarity 129, member B

132 Gene Product Result for
Synonyms: C9orf88 MEG-3 MINERVA OC58 bA356B19.6
UniProtKB ID: Q96TA1, Q4LE55, Q5VVW6, Q5VVW7, Q9BUS2, Q9NT35
Gene ID:
Mouse(227737) family with sequence similarity 129, member B
Rat(362115) family with sequence similarity 129, member B
chicken(771307) family with sequence similarity 129, member B
dog(609251) family with sequence similarity 129, member B
cow(613747) family with sequence similarity 129, member B
domestic cat(101096769) family with sequence similarity 129, member B
naked mole-rat(101696864) family with sequence similarity 129, member B
domestic guinea pig(100727396) family with sequence similarity 129, member B
sheep(101110580) family with sequence similarity 129, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022833 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055741 MISSION® esiRNA esiRNA targeting mouse Fam129b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035534 Rosetta Predictions human pricing
NM_022833 Rosetta Predictions human pricing
NM_001109885 Rosetta Predictions rat pricing
XM_001078459 Rosetta Predictions rat pricing
NM_146119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054592 predicted 926
2 SASI_Hs01_00054593 predicted 1123
3 SASI_Hs01_00054594 predicted 509
4 SASI_Hs01_00054595 predicted 927
5 SASI_Hs01_00054596 predicted 1136
6 SASI_Hs01_00054598 predicted 1148
7 SASI_Hs01_00054599 predicted 508
8 SASI_Hs01_00054600 predicted 500
9 SASI_Hs01_00054601 predicted 593
10 SASI_Hs02_00308205 predicted 321
11 SASI_Hs01_00054597 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025407 predicted 1118
2 SASI_Hs01_00025408 predicted 1311
3 SASI_Hs01_00025409 predicted 705
4 SASI_Hs01_00025410 predicted 1112
5 SASI_Hs01_00025411 predicted 1327
6 SASI_Hs01_00025413 predicted 1334
7 SASI_Hs01_00025414 predicted 703
8 SASI_Hs01_00025415 predicted 688
9 SASI_Hs01_00025416 predicted 779
10 SASI_Hs02_00356147 predicted 511
11 SASI_Hs01_00025412 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250702 predicted 1004
2 SASI_Rn02_00250703 predicted 1298
3 SASI_Rn02_00250704 predicted 1096
4 SASI_Rn02_00250705 predicted 763
5 SASI_Rn02_00250706 predicted 688
6 SASI_Rn02_00250707 predicted 702
7 SASI_Rn02_00250708 predicted 259
8 SASI_Rn02_00250709 predicted 2091
9 SASI_Rn02_00250710 predicted 551
10 SASI_Rn02_00250711 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360846 predicted 1003
2 SASI_Rn02_00360847 predicted 1292
3 SASI_Rn02_00360848 predicted 1095
4 SASI_Rn02_00360849 predicted 763
5 SASI_Rn02_00360850 predicted 693
6 SASI_Rn02_00360851 predicted 705
7 SASI_Rn02_00360852 predicted 260
8 SASI_Rn02_00360853 predicted 2092
9 SASI_Rn02_00360854 predicted 548
10 SASI_Rn02_00360855 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042824 predicted 1241
2 SASI_Mm01_00042825 predicted 716
3 SASI_Mm01_00042826 predicted 335
4 SASI_Mm02_00341782 predicted 1585
5 SASI_Mm01_00042827 predicted 1257
6 SASI_Mm01_00042829 predicted 1395
7 SASI_Mm01_00042830 predicted 496
8 SASI_Mm01_00042831 predicted 775
9 SASI_Mm01_00042832 predicted 205
10 SASI_Mm01_00042833 predicted 367
11 SASI_Mm01_00042828 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146119
VALIDATED
FAM129B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 129, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-1561s1c1
Sequence:CCGGCGTGCTGAAGAAATACGACTACTCGAGTAGTCGTATTTCTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-199s1c1
Sequence:CCGGCGAGAAGATCCTCACAGAGTTCTCGAGAACTCTGTGAGGATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-328s1c1
Sequence:CCGGCCTGGATGAACGCATCATCTTCTCGAGAAGATGATGCGTTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-957s21c1
Sequence:CCGGCTGTGTACCGCCTGGTATTTGCTCGAGCAAATACCAGGCGGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-1563s21c1
Sequence:CCGGTGCTGAAGAAATACGACTATGCTCGAGCATAGTCGTATTTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-629s21c1
Sequence:CCGGCCTTACGCCCGACACTATTACCTCGAGGTAATAGTGTCGGGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-3185s21c1
Sequence:CCGGCCCGTCACCTAATCCTGATAACTCGAGTTATCAGGATTAGGTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-420s21c1
Sequence:CCGGACTATGGGCTGGTGCTATATGCTCGAGCATATAGCACCAGCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146119
VALIDATED
FAM129B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 129, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-1561s1c1
Sequence:CCGGCGTGCTGAAGAAATACGACTACTCGAGTAGTCGTATTTCTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-199s1c1
Sequence:CCGGCGAGAAGATCCTCACAGAGTTCTCGAGAACTCTGTGAGGATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-328s1c1
Sequence:CCGGCCTGGATGAACGCATCATCTTCTCGAGAAGATGATGCGTTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-957s21c1
Sequence:CCGGCTGTGTACCGCCTGGTATTTGCTCGAGCAAATACCAGGCGGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-1563s21c1
Sequence:CCGGTGCTGAAGAAATACGACTATGCTCGAGCATAGTCGTATTTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-629s21c1
Sequence:CCGGCCTTACGCCCGACACTATTACCTCGAGGTAATAGTGTCGGGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-3185s21c1
Sequence:CCGGCCCGTCACCTAATCCTGATAACTCGAGTTATCAGGATTAGGTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-420s21c1
Sequence:CCGGACTATGGGCTGGTGCTATATGCTCGAGCATATAGCACCAGCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146119
VALIDATED
FAM129B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 129, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-1561s1c1
Sequence:CCGGCGTGCTGAAGAAATACGACTACTCGAGTAGTCGTATTTCTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-199s1c1
Sequence:CCGGCGAGAAGATCCTCACAGAGTTCTCGAGAACTCTGTGAGGATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146119.1-328s1c1
Sequence:CCGGCCTGGATGAACGCATCATCTTCTCGAGAAGATGATGCGTTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-957s21c1
Sequence:CCGGCTGTGTACCGCCTGGTATTTGCTCGAGCAAATACCAGGCGGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-1563s21c1
Sequence:CCGGTGCTGAAGAAATACGACTATGCTCGAGCATAGTCGTATTTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-629s21c1
Sequence:CCGGCCTTACGCCCGACACTATTACCTCGAGGTAATAGTGTCGGGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-3185s21c1
Sequence:CCGGCCCGTCACCTAATCCTGATAACTCGAGTTATCAGGATTAGGTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146119.1-420s21c1
Sequence:CCGGACTATGGGCTGGTGCTATATGCTCGAGCATATAGCACCAGCCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022833
VALIDATED
FAM129B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 129, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022833.1-1219s1c1
Sequence:CCGGGCAGAGCTGCTATGAGAAGATCTCGAGATCTTCTCATAGCAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-930s1c1
Sequence:CCGGGAACTGACATGGACCAAATTACTCGAGTAATTTGGTCCATGTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-1331s1c1
Sequence:CCGGCAAATGGACAATGCCGTGTATCTCGAGATACACGGCATTGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-590s1c1
Sequence:CCGGCACTGCAACAATGGAATCCCTCTCGAGAGGGATTCCATTGTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022833.2-3484s1c1
Sequence:CCGGGTCCCTTCTTTGGATGTCCTTCTCGAGAAGGACATCCAAAGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022833.2-2584s1c1
Sequence:CCGGGCCCACCTGAGTCACTTTATTCTCGAGAATAAAGTGACTCAGGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-943s1c1
Sequence:CCGGCCAAATTATCACCTCCAAGGACTCGAGTCCTTGGAGGTGATAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-1574s1c1
Sequence:CCGGGAGCTGATCTTCGAGGACTTTCTCGAGAAAGTCCTCGAAGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-1330s1c1
Sequence:CCGGGCAAATGGACAATGCCGTGTACTCGAGTACACGGCATTGTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-361s1c1
Sequence:CCGGCATCAACAGTGCAGGCTACAACTCGAGTTGTAGCCTGCACTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022833
VALIDATED
FAM129B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 129, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022833.1-1219s1c1
Sequence:CCGGGCAGAGCTGCTATGAGAAGATCTCGAGATCTTCTCATAGCAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-930s1c1
Sequence:CCGGGAACTGACATGGACCAAATTACTCGAGTAATTTGGTCCATGTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-1331s1c1
Sequence:CCGGCAAATGGACAATGCCGTGTATCTCGAGATACACGGCATTGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-590s1c1
Sequence:CCGGCACTGCAACAATGGAATCCCTCTCGAGAGGGATTCCATTGTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022833.2-3484s1c1
Sequence:CCGGGTCCCTTCTTTGGATGTCCTTCTCGAGAAGGACATCCAAAGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022833.2-2584s1c1
Sequence:CCGGGCCCACCTGAGTCACTTTATTCTCGAGAATAAAGTGACTCAGGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-943s1c1
Sequence:CCGGCCAAATTATCACCTCCAAGGACTCGAGTCCTTGGAGGTGATAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-1574s1c1
Sequence:CCGGGAGCTGATCTTCGAGGACTTTCTCGAGAAAGTCCTCGAAGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-1330s1c1
Sequence:CCGGGCAAATGGACAATGCCGTGTACTCGAGTACACGGCATTGTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-361s1c1
Sequence:CCGGCATCAACAGTGCAGGCTACAACTCGAGTTGTAGCCTGCACTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022833
VALIDATED
FAM129B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 129, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022833.1-1219s1c1
Sequence:CCGGGCAGAGCTGCTATGAGAAGATCTCGAGATCTTCTCATAGCAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-930s1c1
Sequence:CCGGGAACTGACATGGACCAAATTACTCGAGTAATTTGGTCCATGTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-1331s1c1
Sequence:CCGGCAAATGGACAATGCCGTGTATCTCGAGATACACGGCATTGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-590s1c1
Sequence:CCGGCACTGCAACAATGGAATCCCTCTCGAGAGGGATTCCATTGTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022833.2-3484s1c1
Sequence:CCGGGTCCCTTCTTTGGATGTCCTTCTCGAGAAGGACATCCAAAGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022833.2-2584s1c1
Sequence:CCGGGCCCACCTGAGTCACTTTATTCTCGAGAATAAAGTGACTCAGGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-943s1c1
Sequence:CCGGCCAAATTATCACCTCCAAGGACTCGAGTCCTTGGAGGTGATAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-1574s1c1
Sequence:CCGGGAGCTGATCTTCGAGGACTTTCTCGAGAAAGTCCTCGAAGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022833.1-1330s1c1
Sequence:CCGGGCAAATGGACAATGCCGTGTACTCGAGTACACGGCATTGTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022833.1-361s1c1
Sequence:CCGGCATCAACAGTGCAGGCTACAACTCGAGTTGTAGCCTGCACTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks