EMAIL THIS PAGE TO A FRIEND

FAM129C

family with sequence similarity 129, member C

Synonyms: BCNP1
UniProtKB ID: Q86XR2, Q7Z6H6, Q86XR3, Q86XR4, Q8TEQ3
Gene ID:
Mouse(100037278) family with sequence similarity 129, member C
Rat(498604) family with sequence similarity 129, member C
cow(101902057) family with sequence similarity 129, member C
domestic cat(101084090) family with sequence similarity 129, member C
dog(610081) family with sequence similarity 129, member C
sheep(101114355) family with sequence similarity 129, member C
domestic guinea pig(100735255) family with sequence similarity 129, member C
naked mole-rat(101711558) family with sequence similarity 129, member C
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173544 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146221 MISSION® esiRNA esiRNA human FAM129C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098524 Rosetta Predictions human pricing
NM_173544 Rosetta Predictions human pricing
XM_001069426 Rosetta Predictions rat pricing
XM_573881 Rosetta Predictions rat pricing
XM_001478428 Rosetta Predictions mouse pricing
XM_001478599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319297 predicted 674
2 SASI_Hs02_00319298 predicted 595
3 SASI_Hs02_00319299 predicted 525
4 SASI_Hs02_00319300 predicted 1428
5 SASI_Hs02_00319301 predicted 1426
6 SASI_Hs02_00319302 predicted 600
7 SASI_Hs02_00319303 predicted 1600
8 SASI_Hs02_00319304 predicted 1759
9 SASI_Hs02_00319305 predicted 1326
10 SASI_Hs02_00319306 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076832 predicted 673
2 SASI_Hs01_00076834 predicted 596
3 SASI_Hs01_00076836 predicted 527
4 SASI_Hs01_00076837 predicted 1426
5 SASI_Hs02_00368344 predicted 1422
6 SASI_Hs02_00368345 predicted 600
7 SASI_Hs01_00076838 predicted 1603
8 SASI_Hs02_00368346 predicted 1759
9 SASI_Hs01_00076841 predicted 1324
10 SASI_Hs02_00368347 predicted 340
11 SASI_Hs01_00076833 predicted 1891
12 SASI_Hs01_00076835 predicted 2038
13 SASI_Hs01_00076839 predicted 645
14 SASI_Hs01_00076840 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327985 predicted 971
2 SASI_Rn02_00327986 predicted 716
3 SASI_Rn02_00327987 predicted 1786
4 SASI_Rn02_00327988 predicted 1324
5 SASI_Rn02_00327989 predicted 1008
6 SASI_Rn02_00327990 predicted 241
7 SASI_Rn02_00327991 predicted 729
8 SASI_Rn02_00327992 predicted 290
9 SASI_Rn02_00327993 predicted 1120
10 SASI_Rn02_00327994 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400973 predicted 272
2 SASI_Rn02_00400974 predicted 301
3 SASI_Rn02_00400975 predicted 363
4 SASI_Rn02_00400976 predicted 241
5 SASI_Rn02_00400977 predicted 367
6 SASI_Rn02_00400978 predicted 365
7 SASI_Rn02_00400979 predicted 356
8 SASI_Rn02_00400980 predicted 285
9 SASI_Rn02_00400981 predicted 235
10 SASI_Rn02_00400982 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00402579 predicted 2152
2 SASI_Mm02_00402580 predicted 2204
3 SASI_Mm02_00402581 predicted 2204
4 SASI_Mm02_00402582 predicted 2234
5 SASI_Mm02_00402583 predicted 1593
6 SASI_Mm02_00402584 predicted 2135
7 SASI_Mm02_00402585 predicted 1579
8 SASI_Mm02_00402586 predicted 1607
9 SASI_Mm02_00402587 predicted 1652
10 SASI_Mm02_00402588 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00403847 predicted 406
2 SASI_Mm02_00403848 predicted 1444
3 SASI_Mm02_00403849 predicted 2149
4 SASI_Mm02_00403850 predicted 2204
5 SASI_Mm02_00403851 predicted 1656
6 SASI_Mm02_00403852 predicted 2240
7 SASI_Mm02_00403853 predicted 1129
8 SASI_Mm02_00403854 predicted 1099
9 SASI_Mm02_00403855 predicted 1242
10 SASI_Mm02_00403856 predicted 1596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173544
FAM129C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 129, member C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-2134s1c1
Sequence:CCGGCGTGTGTTCTTGGTTCAGCTTCTCGAGAAGCTGAACCAAGAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-1920s1c1
Sequence:CCGGCAATGATGTATCCTGCACTCTCTCGAGAGAGTGCAGGATACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-647s1c1
Sequence:CCGGCTGAATCCTTGGGAGACCATACTCGAGTATGGTCTCCCAAGGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1393s1c1
Sequence:CCGGCGCAGGGAGGTTTACTCATTTCTCGAGAAATGAGTAAACCTCCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1985s1c1
Sequence:CCGGCAAATCTTAACTTGGTGTCAACTCGAGTTGACACCAAGTTAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1984s1c1
Sequence:CCGGCCAAATCTTAACTTGGTGTCACTCGAGTGACACCAAGTTAAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1671s1c1
Sequence:CCGGGCTGAAGAAATTCAAATCGGACTCGAGTCCGATTTGAATTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-2066s1c1
Sequence:CCGGCTAACTGGATATTGGCAGCTTCTCGAGAAGCTGCCAATATCCAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173544
FAM129C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 129, member C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-2134s1c1
Sequence:CCGGCGTGTGTTCTTGGTTCAGCTTCTCGAGAAGCTGAACCAAGAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-1920s1c1
Sequence:CCGGCAATGATGTATCCTGCACTCTCTCGAGAGAGTGCAGGATACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-647s1c1
Sequence:CCGGCTGAATCCTTGGGAGACCATACTCGAGTATGGTCTCCCAAGGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1393s1c1
Sequence:CCGGCGCAGGGAGGTTTACTCATTTCTCGAGAAATGAGTAAACCTCCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1985s1c1
Sequence:CCGGCAAATCTTAACTTGGTGTCAACTCGAGTTGACACCAAGTTAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1984s1c1
Sequence:CCGGCCAAATCTTAACTTGGTGTCACTCGAGTGACACCAAGTTAAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1671s1c1
Sequence:CCGGGCTGAAGAAATTCAAATCGGACTCGAGTCCGATTTGAATTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-2066s1c1
Sequence:CCGGCTAACTGGATATTGGCAGCTTCTCGAGAAGCTGCCAATATCCAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173544
FAM129C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 129, member C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-2134s1c1
Sequence:CCGGCGTGTGTTCTTGGTTCAGCTTCTCGAGAAGCTGAACCAAGAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-1920s1c1
Sequence:CCGGCAATGATGTATCCTGCACTCTCTCGAGAGAGTGCAGGATACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173544.2-647s1c1
Sequence:CCGGCTGAATCCTTGGGAGACCATACTCGAGTATGGTCTCCCAAGGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1393s1c1
Sequence:CCGGCGCAGGGAGGTTTACTCATTTCTCGAGAAATGAGTAAACCTCCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1985s1c1
Sequence:CCGGCAAATCTTAACTTGGTGTCAACTCGAGTTGACACCAAGTTAAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1984s1c1
Sequence:CCGGCCAAATCTTAACTTGGTGTCACTCGAGTGACACCAAGTTAAGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-1671s1c1
Sequence:CCGGGCTGAAGAAATTCAAATCGGACTCGAGTCCGATTTGAATTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173544.2-2066s1c1
Sequence:CCGGCTAACTGGATATTGGCAGCTTCTCGAGAAGCTGCCAATATCCAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks