EMAIL THIS PAGE TO A FRIEND

FAM131A

family with sequence similarity 131, member A

73 Gene Product Result for
Synonyms: C3orf40 FLAT715 PRO1378
UniProtKB ID: Q6UXB0, D3DNT6, G5E9B1, Q8TA84
Gene ID:
Mouse(78408) family with sequence similarity 131, member A
Rat(100360487) family with sequence similarity 131, member A
naked mole-rat(101707028) family with sequence similarity 131, member A
domestic guinea pig(100725775) family with sequence similarity 131, member A
sheep(101120127) family with sequence similarity 131, member A
Zebrafish(100136860) family with sequence similarity 131, member A
chicken(100858502) family with sequence similarity 131, member A
cow(538666) family with sequence similarity 131, member A
domestic cat(101085398) family with sequence similarity 131, member A
dog(607236) family with sequence similarity 131, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042800 Anti-FAM131A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144635 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144635 Rosetta Predictions human pricing
NM_133778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364476 predicted 1845
2 SASI_Hs01_00106348 predicted 1747
3 SASI_Hs02_00364477 predicted 1402
4 SASI_Hs01_00106349 predicted 2509
5 SASI_Hs01_00106350 predicted 1409
6 SASI_Hs01_00106351 predicted 2658
7 SASI_Hs01_00106352 predicted 1622
8 SASI_Hs01_00106354 predicted 1819
9 SASI_Hs01_00106355 predicted 2797
10 SASI_Hs01_00106356 predicted 2360
11 SASI_Hs01_00106353 predicted 1395
12 SASI_Hs01_00106357 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105802 predicted 339
2 SASI_Mm01_00105803 predicted 1055
3 SASI_Mm01_00105804 predicted 611
4 SASI_Mm01_00105805 predicted 244
5 SASI_Mm01_00105806 predicted 685
6 SASI_Mm01_00105807 predicted 246
7 SASI_Mm01_00105808 predicted 1078
8 SASI_Mm01_00105809 predicted 290
9 SASI_Mm01_00105810 predicted 254
10 SASI_Mm01_00105811 predicted 1179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144635
VALIDATED
FAM131A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 131, member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144635.3-3022s1c1
Sequence:CCGGGCTTTGGAATGATGAAAGCATCTCGAGATGCTTTCATCATTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144635.3-2929s21c1
Sequence:CCGGCACCTCTCCATCGTCTCTAAACTCGAGTTTAGAGACGATGGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144635.3-2104s21c1
Sequence:CCGGATGAGCTGCTTCTCGCCAAACCTCGAGGTTTGGCGAGAAGCAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1849s21c1
Sequence:CCGGCCACTGATGACTCCTATGATGCTCGAGCATCATAGGAGTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1498s21c1
Sequence:CCGGTTCACATGGATCCTAACTACTCTCGAGAGTAGTTAGGATCCATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1403s21c1
Sequence:CCGGACATCCCTTTGGAACTGTTTCCTCGAGGAAACAGTTCCAAAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144635
VALIDATED
FAM131A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 131, member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144635.3-3022s1c1
Sequence:CCGGGCTTTGGAATGATGAAAGCATCTCGAGATGCTTTCATCATTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144635.3-2929s21c1
Sequence:CCGGCACCTCTCCATCGTCTCTAAACTCGAGTTTAGAGACGATGGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144635.3-2104s21c1
Sequence:CCGGATGAGCTGCTTCTCGCCAAACCTCGAGGTTTGGCGAGAAGCAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1849s21c1
Sequence:CCGGCCACTGATGACTCCTATGATGCTCGAGCATCATAGGAGTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1498s21c1
Sequence:CCGGTTCACATGGATCCTAACTACTCTCGAGAGTAGTTAGGATCCATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1403s21c1
Sequence:CCGGACATCCCTTTGGAACTGTTTCCTCGAGGAAACAGTTCCAAAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144635
VALIDATED
FAM131A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 131, member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167861    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144635.3-3022s1c1
Sequence:CCGGGCTTTGGAATGATGAAAGCATCTCGAGATGCTTTCATCATTCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144635.3-2929s21c1
Sequence:CCGGCACCTCTCCATCGTCTCTAAACTCGAGTTTAGAGACGATGGAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144635.3-2104s21c1
Sequence:CCGGATGAGCTGCTTCTCGCCAAACCTCGAGGTTTGGCGAGAAGCAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1849s21c1
Sequence:CCGGCCACTGATGACTCCTATGATGCTCGAGCATCATAGGAGTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1498s21c1
Sequence:CCGGTTCACATGGATCCTAACTACTCTCGAGAGTAGTTAGGATCCATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144635.3-1403s21c1
Sequence:CCGGACATCCCTTTGGAACTGTTTCCTCGAGGAAACAGTTCCAAAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133778
FAM131A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 131, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-545s21c1
Sequence:CCGGTGGCCGAGCAGTTTGCTATTGCTCGAGCAATAGCAAACTGCTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133778.2-1856s21c1
Sequence:CCGGAGTAAGGGCTCTGCTTGTTACCTCGAGGTAACAAGCAGAGCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-251s21c1
Sequence:CCGGAGGACTTGCCAGAGGTGAATGCTCGAGCATTCACCTCTGGCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-603s21c1
Sequence:CCGGTGATGACTCCACCGATGATTCCTCGAGGAATCATCGGTGGAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-345s21c1
Sequence:CCGGATCGTCCCTGCATGGTATTTCCTCGAGGAAATACCATGCAGGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133778
FAM131A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 131, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-545s21c1
Sequence:CCGGTGGCCGAGCAGTTTGCTATTGCTCGAGCAATAGCAAACTGCTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133778.2-1856s21c1
Sequence:CCGGAGTAAGGGCTCTGCTTGTTACCTCGAGGTAACAAGCAGAGCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-251s21c1
Sequence:CCGGAGGACTTGCCAGAGGTGAATGCTCGAGCATTCACCTCTGGCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-603s21c1
Sequence:CCGGTGATGACTCCACCGATGATTCCTCGAGGAATCATCGGTGGAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-345s21c1
Sequence:CCGGATCGTCCCTGCATGGTATTTCCTCGAGGAAATACCATGCAGGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133778
FAM131A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 131, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-545s21c1
Sequence:CCGGTGGCCGAGCAGTTTGCTATTGCTCGAGCAATAGCAAACTGCTCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133778.2-1856s21c1
Sequence:CCGGAGTAAGGGCTCTGCTTGTTACCTCGAGGTAACAAGCAGAGCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-251s21c1
Sequence:CCGGAGGACTTGCCAGAGGTGAATGCTCGAGCATTCACCTCTGGCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-603s21c1
Sequence:CCGGTGATGACTCCACCGATGATTCCTCGAGGAATCATCGGTGGAGTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133778.2-345s21c1
Sequence:CCGGATCGTCCCTGCATGGTATTTCCTCGAGGAAATACCATGCAGGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks