EMAIL THIS PAGE TO A FRIEND

FAM131B

family with sequence similarity 131, member B

126 Gene Product Result for
Gene ID:
Mouse(76156) family with sequence similarity 131, member B
Rat(500102) family with sequence similarity 131, member B
chicken(768450) family with sequence similarity 131, member B
cow(617268) family with sequence similarity 131, member B
domestic cat(101099539) family with sequence similarity 131, member B
dog(608789) family with sequence similarity 131, member B
sheep(101123371) family with sequence similarity 131, member B
domestic guinea pig(100727799) family with sequence similarity 131, member B
naked mole-rat(101709441) family with sequence similarity 131, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031690 Rosetta Predictions human pricing
NM_014690 Rosetta Predictions human pricing
NM_001025046 Rosetta Predictions rat pricing
NM_001113327 Rosetta Predictions mouse pricing
NM_029528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205038 predicted 579
2 SASI_Hs01_00205040 predicted 770
3 SASI_Hs01_00205041 predicted 907
4 SASI_Hs02_00307699 predicted 412
5 SASI_Hs01_00205043 predicted 610
6 SASI_Hs01_00205047 predicted 1176
7 SASI_Hs02_00307700 predicted 710
8 SASI_Hs02_00307701 predicted 908
9 SASI_Hs02_00307702 predicted 674
10 SASI_Hs01_00205046 predicted 1116
11 SASI_Hs01_00205039 predicted 321
12 SASI_Hs01_00205042 predicted 284
13 SASI_Hs01_00205044 predicted 337
14 SASI_Hs01_00205045 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128926 predicted 474
2 SASI_Hs01_00128928 predicted 664
3 SASI_Hs01_00128929 predicted 799
4 SASI_Hs02_00346064 predicted 297
5 SASI_Hs01_00128931 predicted 504
6 SASI_Hs01_00128934 predicted 1064
7 SASI_Hs01_00128935 predicted 605
8 SASI_Hs02_00346065 predicted 808
9 SASI_Hs02_00346066 predicted 561
10 SASI_Hs02_00346067 predicted 1008
11 SASI_Hs01_00128927 predicted 1789
12 SASI_Hs01_00128930 predicted 1758
13 SASI_Hs01_00128932 predicted 1821
14 SASI_Hs01_00128933 predicted 2869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062253 predicted 639
2 SASI_Rn01_00062254 predicted 475
3 SASI_Rn01_00062255 predicted 271
4 SASI_Rn01_00062256 predicted 822
5 SASI_Rn01_00062257 predicted 849
6 SASI_Rn01_00062258 predicted 514
7 SASI_Rn01_00062259 predicted 545
8 SASI_Rn01_00062260 predicted 311
9 SASI_Rn01_00062261 predicted 613
10 SASI_Rn01_00062262 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307363 predicted 1488
2 SASI_Mm02_00307364 predicted 1148
3 SASI_Mm02_00307365 predicted 841
4 SASI_Mm02_00307366 predicted 553
5 SASI_Mm02_00307367 predicted 1111
6 SASI_Mm02_00307368 predicted 1163
7 SASI_Mm02_00307369 predicted 581
8 SASI_Mm02_00307370 predicted 697
9 SASI_Mm02_00307371 predicted 656
10 SASI_Mm02_00307372 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335481 predicted 1527
2 SASI_Mm01_00054626 predicted 1177
3 SASI_Mm01_00054629 predicted 881
4 SASI_Mm01_00054630 predicted 582
5 SASI_Mm01_00054631 predicted 1147
6 SASI_Mm01_00054632 predicted 1196
7 SASI_Mm02_00335482 predicted 621
8 SASI_Mm01_00054633 predicted 737
9 SASI_Mm01_00054634 predicted 697
10 SASI_Mm01_00054635 predicted 761
11 SASI_Mm01_00054627 predicted 559
12 SASI_Mm01_00054628 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029528
VALIDATED
FAM131B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 131, member B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029528.4-1533s21c1
Sequence:CCGGTTCGTCGCGCTGAACACTGAACTCGAGTTCAGTGTTCAGCGCGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-306s21c1
Sequence:CCGGAGAGCAAACACGAACAGATTTCTCGAGAAATCTGTTCGTGTTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-330s21c1
Sequence:CCGGCTGGGACGGCATCAATCTTTCCTCGAGGAAAGATTGATGCCGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-380s21c1
Sequence:CCGGAGCTTAAGCGAAACTCTAATGCTCGAGCATTAGAGTTTCGCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-634s21c1
Sequence:CCGGGCAGGTGTCATGGAACAGTTTCTCGAGAAACTGTTCCATGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-871s21c1
Sequence:CCGGGCAAGTGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-535s21c1
Sequence:CCGGGCTCCAACAATTCAGCCACAACTCGAGTTGTGGCTGAATTGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-1370s1c1
Sequence:CCGGGCACTCCAGAAACCCGTCATTCTCGAGAATGACGGGTTTCTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-573s1c1
Sequence:CCGGGCAGGTGTCATGGAACAGTTTCTCGAGAAACTGTTCCATGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029528.1-607s1c1
Sequence:CCGGCTACACTTATGGCTTGGTCTTCTCGAGAAGACCAAGCCATAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-810s1c1
Sequence:CCGGGCAAGTGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-474s1c1
Sequence:CCGGGCTCCAACAATTCAGCCACAACTCGAGTTGTGGCTGAATTGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029528
VALIDATED
FAM131B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 131, member B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029528.4-1533s21c1
Sequence:CCGGTTCGTCGCGCTGAACACTGAACTCGAGTTCAGTGTTCAGCGCGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-306s21c1
Sequence:CCGGAGAGCAAACACGAACAGATTTCTCGAGAAATCTGTTCGTGTTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-330s21c1
Sequence:CCGGCTGGGACGGCATCAATCTTTCCTCGAGGAAAGATTGATGCCGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-380s21c1
Sequence:CCGGAGCTTAAGCGAAACTCTAATGCTCGAGCATTAGAGTTTCGCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-634s21c1
Sequence:CCGGGCAGGTGTCATGGAACAGTTTCTCGAGAAACTGTTCCATGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-871s21c1
Sequence:CCGGGCAAGTGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-535s21c1
Sequence:CCGGGCTCCAACAATTCAGCCACAACTCGAGTTGTGGCTGAATTGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-1370s1c1
Sequence:CCGGGCACTCCAGAAACCCGTCATTCTCGAGAATGACGGGTTTCTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-573s1c1
Sequence:CCGGGCAGGTGTCATGGAACAGTTTCTCGAGAAACTGTTCCATGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029528.1-607s1c1
Sequence:CCGGCTACACTTATGGCTTGGTCTTCTCGAGAAGACCAAGCCATAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-810s1c1
Sequence:CCGGGCAAGTGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-474s1c1
Sequence:CCGGGCTCCAACAATTCAGCCACAACTCGAGTTGTGGCTGAATTGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029528
VALIDATED
FAM131B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 131, member B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029528.4-1533s21c1
Sequence:CCGGTTCGTCGCGCTGAACACTGAACTCGAGTTCAGTGTTCAGCGCGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-306s21c1
Sequence:CCGGAGAGCAAACACGAACAGATTTCTCGAGAAATCTGTTCGTGTTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-330s21c1
Sequence:CCGGCTGGGACGGCATCAATCTTTCCTCGAGGAAAGATTGATGCCGTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-380s21c1
Sequence:CCGGAGCTTAAGCGAAACTCTAATGCTCGAGCATTAGAGTTTCGCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-634s21c1
Sequence:CCGGGCAGGTGTCATGGAACAGTTTCTCGAGAAACTGTTCCATGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-871s21c1
Sequence:CCGGGCAAGTGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029528.4-535s21c1
Sequence:CCGGGCTCCAACAATTCAGCCACAACTCGAGTTGTGGCTGAATTGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-1370s1c1
Sequence:CCGGGCACTCCAGAAACCCGTCATTCTCGAGAATGACGGGTTTCTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-573s1c1
Sequence:CCGGGCAGGTGTCATGGAACAGTTTCTCGAGAAACTGTTCCATGACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029528.1-607s1c1
Sequence:CCGGCTACACTTATGGCTTGGTCTTCTCGAGAAGACCAAGCCATAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-810s1c1
Sequence:CCGGGCAAGTGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029528.1-474s1c1
Sequence:CCGGGCTCCAACAATTCAGCCACAACTCGAGTTGTGGCTGAATTGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014690
FAM131B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 131, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014690.4-258s21c1
Sequence:CCGGACTCTAACGCCTATGGCATTGCTCGAGCAATGCCATAGGCGTTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014690.4-776s21c1
Sequence:CCGGTCCTATCTTGGGCCTGCATTTCTCGAGAAATGCAGGCCCAAGATAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014690.2-2873s1c1
Sequence:CCGGCCAGGCTTACACTCTTAGAAACTCGAGTTTCTAAGAGTGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1759s1c1
Sequence:CCGGCTGAGCAAACTCGAACTGATTCTCGAGAATCAGTTCGAGTTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-2325s1c1
Sequence:CCGGGCCAGCGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1830s1c1
Sequence:CCGGCCGAAGCTTAAGCGAAACTTTCTCGAGAAAGTTTCGCTTAAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1831s1c1
Sequence:CCGGCGAAGCTTAAGCGAAACTTTACTCGAGTAAAGTTTCGCTTAAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014690
FAM131B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 131, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014690.4-258s21c1
Sequence:CCGGACTCTAACGCCTATGGCATTGCTCGAGCAATGCCATAGGCGTTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014690.4-776s21c1
Sequence:CCGGTCCTATCTTGGGCCTGCATTTCTCGAGAAATGCAGGCCCAAGATAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014690.2-2873s1c1
Sequence:CCGGCCAGGCTTACACTCTTAGAAACTCGAGTTTCTAAGAGTGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1759s1c1
Sequence:CCGGCTGAGCAAACTCGAACTGATTCTCGAGAATCAGTTCGAGTTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-2325s1c1
Sequence:CCGGGCCAGCGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1830s1c1
Sequence:CCGGCCGAAGCTTAAGCGAAACTTTCTCGAGAAAGTTTCGCTTAAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1831s1c1
Sequence:CCGGCGAAGCTTAAGCGAAACTTTACTCGAGTAAAGTTTCGCTTAAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014690
FAM131B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 131, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014690.4-258s21c1
Sequence:CCGGACTCTAACGCCTATGGCATTGCTCGAGCAATGCCATAGGCGTTAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014690.4-776s21c1
Sequence:CCGGTCCTATCTTGGGCCTGCATTTCTCGAGAAATGCAGGCCCAAGATAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014690.2-2873s1c1
Sequence:CCGGCCAGGCTTACACTCTTAGAAACTCGAGTTTCTAAGAGTGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1759s1c1
Sequence:CCGGCTGAGCAAACTCGAACTGATTCTCGAGAATCAGTTCGAGTTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-2325s1c1
Sequence:CCGGGCCAGCGATCAGTCCCTCATTCTCGAGAATGAGGGACTGATCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1830s1c1
Sequence:CCGGCCGAAGCTTAAGCGAAACTTTCTCGAGAAAGTTTCGCTTAAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014690.2-1831s1c1
Sequence:CCGGCGAAGCTTAAGCGAAACTTTACTCGAGTAAAGTTTCGCTTAAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks