EMAIL THIS PAGE TO A FRIEND

FAM131C

family with sequence similarity 131, member C

54 Gene Product Result for
Synonyms: C1orf117 RP11-5P18.9
UniProtKB ID: Q96AQ9, Q5T5Q5, Q8N3X3, Q8N9P9
Gene ID:
Mouse(277743) family with sequence similarity 131, member C
Rat(690880) family with sequence similarity 131, member C
Zebrafish(619198) family with sequence similarity 131, member C
dog(607065) family with sequence similarity 131, member C
cow(618019) family with sequence similarity 131, member C
domestic cat(101085224) family with sequence similarity 131, member C
naked mole-rat(101713945) family with sequence similarity 131, member C
domestic guinea pig(100713015) family with sequence similarity 131, member C
sheep(101111352) family with sequence similarity 131, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182623 Rosetta Predictions human pricing
XM_001076007 Rosetta Predictions rat pricing
NM_001085513 Rosetta Predictions mouse pricing
XM_204104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370766 predicted 578
2 SASI_Hs01_00146231 predicted 467
3 SASI_Hs02_00370767 predicted 467
4 SASI_Hs02_00370768 predicted 681
5 SASI_Hs02_00370769 predicted 1374
6 SASI_Hs01_00146229 predicted 787
7 SASI_Hs01_00146232 predicted 1436
8 SASI_Hs01_00146233 predicted 1015
9 SASI_Hs02_00370770 predicted 1189
10 SASI_Hs01_00146227 predicted 1437
11 SASI_Hs01_00146226 predicted 1151
12 SASI_Hs01_00146228 predicted 543
13 SASI_Hs01_00146230 predicted 1276
14 SASI_Hs01_00146234 predicted 555
15 SASI_Hs01_00146235 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351743 predicted 452
2 SASI_Rn02_00351744 predicted 390
3 SASI_Rn02_00351745 predicted 436
4 SASI_Rn02_00351746 predicted 326
5 SASI_Rn02_00351747 predicted 345
6 SASI_Rn02_00351748 predicted 304
7 SASI_Rn02_00351749 predicted 557
8 SASI_Rn02_00351750 predicted 487
9 SASI_Rn02_00351751 predicted 318
10 SASI_Rn02_00351752 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300711 predicted 269
2 SASI_Mm02_00300712 predicted 676
3 SASI_Mm02_00300713 predicted 230
4 SASI_Mm02_00300714 predicted 274
5 SASI_Mm02_00300715 predicted 898
6 SASI_Mm02_00300716 predicted 573
7 SASI_Mm02_00300717 predicted 1138
8 SASI_Mm02_00300718 predicted 970
9 SASI_Mm02_00300719 predicted 272
10 SASI_Mm02_00300720 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243945 predicted 298
2 SASI_Mm01_00243946 predicted 387
3 SASI_Mm01_00243947 predicted 238
4 SASI_Mm01_00243948 predicted 354
5 SASI_Mm01_00243949 predicted 247
6 SASI_Mm01_00243950 predicted 372
7 SASI_Mm01_00243951 predicted 326
8 SASI_Mm01_00243952 predicted 403
9 SASI_Mm01_00243953 predicted 378
10 SASI_Mm01_00243954 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182623
FAM131C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 131, member C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-303s1c1
Sequence:CCGGCAGATGGATTTCTGTTGGGATCTCGAGATCCCAACAGAAATCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-439s1c1
Sequence:CCGGGCATCAAGGACCACATCACAACTCGAGTTGTGATGTGGTCCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-287s1c1
Sequence:CCGGCATTGGCAAGGACAAACAGATCTCGAGATCTGTTTGTCCTTGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-1009s21c1
Sequence:CCGGGGAGGACGAGGTGTTCTATAACTCGAGTTATAGAACACCTCGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-471s21c1
Sequence:CCGGGCATCAAGGACCACATCACAACTCGAGTTGTGATGTGGTCCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-315s21c1
Sequence:CCGGGTGTCATTGGCAAGGACAAACCTCGAGGTTTGTCCTTGCCAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-749s21c1
Sequence:CCGGCAAGATCTGGAGAGCATCTACCTCGAGGTAGATGCTCTCCAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182623
FAM131C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 131, member C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-303s1c1
Sequence:CCGGCAGATGGATTTCTGTTGGGATCTCGAGATCCCAACAGAAATCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-439s1c1
Sequence:CCGGGCATCAAGGACCACATCACAACTCGAGTTGTGATGTGGTCCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-287s1c1
Sequence:CCGGCATTGGCAAGGACAAACAGATCTCGAGATCTGTTTGTCCTTGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-1009s21c1
Sequence:CCGGGGAGGACGAGGTGTTCTATAACTCGAGTTATAGAACACCTCGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-471s21c1
Sequence:CCGGGCATCAAGGACCACATCACAACTCGAGTTGTGATGTGGTCCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-315s21c1
Sequence:CCGGGTGTCATTGGCAAGGACAAACCTCGAGGTTTGTCCTTGCCAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-749s21c1
Sequence:CCGGCAAGATCTGGAGAGCATCTACCTCGAGGTAGATGCTCTCCAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182623
FAM131C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 131, member C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-303s1c1
Sequence:CCGGCAGATGGATTTCTGTTGGGATCTCGAGATCCCAACAGAAATCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-439s1c1
Sequence:CCGGGCATCAAGGACCACATCACAACTCGAGTTGTGATGTGGTCCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182623.1-287s1c1
Sequence:CCGGCATTGGCAAGGACAAACAGATCTCGAGATCTGTTTGTCCTTGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-1009s21c1
Sequence:CCGGGGAGGACGAGGTGTTCTATAACTCGAGTTATAGAACACCTCGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-471s21c1
Sequence:CCGGGCATCAAGGACCACATCACAACTCGAGTTGTGATGTGGTCCTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-315s21c1
Sequence:CCGGGTGTCATTGGCAAGGACAAACCTCGAGGTTTGTCCTTGCCAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182623.2-749s21c1
Sequence:CCGGCAAGATCTGGAGAGCATCTACCTCGAGGTAGATGCTCTCCAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085513
FAM131C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 131, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-218s21c1
Sequence:CCGGCAAGGACAAGCAGATGGATTTCTCGAGAAATCCATCTGCTTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-192s21c1
Sequence:CCGGGCCATTGTTCCGGACCATGTTCTCGAGAACATGGTCCGGAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-582s21c1
Sequence:CCGGTCCTCTCTGGATGACGAAGAACTCGAGTTCTTCGTCATCCAGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085513.1-977s21c1
Sequence:CCGGTCTCGACTCCTCCGTACAAACCTCGAGGTTTGTACGGAGGAGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-268s21c1
Sequence:CCGGAGACCACCAATGGCTACATATCTCGAGATATGTAGCCATTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085513
FAM131C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 131, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-218s21c1
Sequence:CCGGCAAGGACAAGCAGATGGATTTCTCGAGAAATCCATCTGCTTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-192s21c1
Sequence:CCGGGCCATTGTTCCGGACCATGTTCTCGAGAACATGGTCCGGAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-582s21c1
Sequence:CCGGTCCTCTCTGGATGACGAAGAACTCGAGTTCTTCGTCATCCAGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085513.1-977s21c1
Sequence:CCGGTCTCGACTCCTCCGTACAAACCTCGAGGTTTGTACGGAGGAGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-268s21c1
Sequence:CCGGAGACCACCAATGGCTACATATCTCGAGATATGTAGCCATTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085513
FAM131C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 131, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-218s21c1
Sequence:CCGGCAAGGACAAGCAGATGGATTTCTCGAGAAATCCATCTGCTTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-192s21c1
Sequence:CCGGGCCATTGTTCCGGACCATGTTCTCGAGAACATGGTCCGGAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-582s21c1
Sequence:CCGGTCCTCTCTGGATGACGAAGAACTCGAGTTCTTCGTCATCCAGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085513.1-977s21c1
Sequence:CCGGTCTCGACTCCTCCGTACAAACCTCGAGGTTTGTACGGAGGAGTCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085513.1-268s21c1
Sequence:CCGGAGACCACCAATGGCTACATATCTCGAGATATGTAGCCATTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks