EMAIL THIS PAGE TO A FRIEND

FAM132A

family with sequence similarity 132, member A

64 Gene Product Result for
Synonyms: C1QDC2 C1QTNF12 CTRP12
UniProtKB ID: Q5T7M4, Q5EBL5
Gene ID:
Mouse(67389) family with sequence similarity 132, member A
Rat(313774) family with sequence similarity 132, member A
sheep(101105516) family with sequence similarity 132, member A
domestic guinea pig(100730503) family with sequence similarity 132, member A
naked mole-rat(101720862) family with sequence similarity 132, member A
Zebrafish(790933) family with sequence similarity 132, member A
cow(506102) family with sequence similarity 132, member A
domestic cat(101083498) family with sequence similarity 132, member A
dog(100683774) family with sequence similarity 132, member A
chicken(419422) family with sequence similarity 132, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001014980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014980 Rosetta Predictions human pricing
XM_371208 Rosetta Predictions human pricing
XM_928940 Rosetta Predictions human pricing
NM_001108000 Rosetta Predictions rat pricing
NM_026125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306600 predicted 367
2 SASI_Hs02_00306601 predicted 370
3 SASI_Hs02_00306602 predicted 245
4 SASI_Hs02_00306603 predicted 714
5 SASI_Hs02_00306604 predicted 348
6 SASI_Hs02_00306605 predicted 802
7 SASI_Hs02_00306606 predicted 221
8 SASI_Hs02_00306607 predicted 310
9 SASI_Hs02_00306608 predicted 714
10 SASI_Hs02_00306609 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265694 predicted 344
2 SASI_Hs01_00265695 predicted 352
3 SASI_Hs01_00265696 predicted 338
4 SASI_Hs01_00265697 predicted 636
5 SASI_Hs01_00265698 predicted 631
6 SASI_Hs01_00265699 predicted 342
7 SASI_Hs01_00265700 predicted 636
8 SASI_Hs01_00265701 predicted 477
9 SASI_Hs01_00265702 predicted 473
10 SASI_Hs01_00265703 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262123 predicted 372
2 SASI_Hs01_00262124 predicted 297
3 SASI_Hs01_00262125 predicted 265
4 SASI_Hs01_00262126 predicted 369
5 SASI_Hs01_00262127 predicted 375
6 SASI_Hs01_00262128 predicted 362
7 SASI_Hs01_00262129 predicted 247
8 SASI_Hs01_00262130 predicted 356
9 SASI_Hs01_00262131 predicted 273
10 SASI_Hs01_00262132 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234375 predicted 759
2 SASI_Rn02_00234376 predicted 988
3 SASI_Rn02_00234377 predicted 658
4 SASI_Rn02_00234378 predicted 771
5 SASI_Rn02_00234379 predicted 355
6 SASI_Rn02_00234380 predicted 776
7 SASI_Rn02_00234381 predicted 729
8 SASI_Rn02_00234382 predicted 281
9 SASI_Rn02_00234383 predicted 457
10 SASI_Rn02_00234384 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033923 predicted 659
2 SASI_Mm01_00033924 predicted 484
3 SASI_Mm01_00033926 predicted 484
4 SASI_Mm01_00033928 predicted 790
5 SASI_Mm01_00033929 predicted 730
6 SASI_Mm01_00033930 predicted 1074
7 SASI_Mm01_00033931 predicted 728
8 SASI_Mm01_00033932 predicted 448
9 SASI_Mm02_00329703 predicted 397
10 SASI_Mm02_00329704 predicted 876
11 SASI_Mm01_00033925 predicted 971
12 SASI_Mm01_00033927 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026125
VALIDATED
FAM132A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 132, member A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-453s21c1
Sequence:CCGGTGCCCACATGACGTGGTTGAACTCGAGTTCAACCACGTCATGTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026125.2-683s21c1
Sequence:CCGGGGCTACCAGACACATTGTTACCTCGAGGTAACAATGTGTCTGGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-799s21c1
Sequence:CCGGGGATTCCAAGCTCCTACTACTCTCGAGAGTAGTAGGAGCTTGGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-338s21c1
Sequence:CCGGAGAAGTCTCGGCAGCTGTTTGCTCGAGCAAACAGCTGCCGAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-988s21c1
Sequence:CCGGGAGTCCTTGTGTCATCGTCATCTCGAGATGACGATGACACAAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-736s21c1
Sequence:CCGGGCCTTCTACTGCCGTTTGAAACTCGAGTTTCAAACGGCAGTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-658s21c1
Sequence:CCGGGAGGCCACAGAACTTCGATTCCTCGAGGAATCGAAGTTCTGTGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-632s1c1
Sequence:CCGGCTGCAGGAATTTCAGGAGATACTCGAGTATCTCCTGAAATTCCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026125.1-1081s1c1
Sequence:CCGGGCATCTACAGTCTGGACAGTACTCGAGTACTGTCCAGACTGTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-989s1c1
Sequence:CCGGGAGTCCTTGTGTCATCGTCATCTCGAGATGACGATGACACAAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-623s1c1
Sequence:CCGGGAGGCCTTACTGCAGGAATTTCTCGAGAAATTCCTGCAGTAAGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-737s1c1
Sequence:CCGGGCCTTCTACTGCCGTTTGAAACTCGAGTTTCAAACGGCAGTAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026125
VALIDATED
FAM132A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 132, member A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-453s21c1
Sequence:CCGGTGCCCACATGACGTGGTTGAACTCGAGTTCAACCACGTCATGTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026125.2-683s21c1
Sequence:CCGGGGCTACCAGACACATTGTTACCTCGAGGTAACAATGTGTCTGGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-799s21c1
Sequence:CCGGGGATTCCAAGCTCCTACTACTCTCGAGAGTAGTAGGAGCTTGGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-338s21c1
Sequence:CCGGAGAAGTCTCGGCAGCTGTTTGCTCGAGCAAACAGCTGCCGAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-988s21c1
Sequence:CCGGGAGTCCTTGTGTCATCGTCATCTCGAGATGACGATGACACAAGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-736s21c1
Sequence:CCGGGCCTTCTACTGCCGTTTGAAACTCGAGTTTCAAACGGCAGTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-658s21c1
Sequence:CCGGGAGGCCACAGAACTTCGATTCCTCGAGGAATCGAAGTTCTGTGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-632s1c1
Sequence:CCGGCTGCAGGAATTTCAGGAGATACTCGAGTATCTCCTGAAATTCCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026125.1-1081s1c1
Sequence:CCGGGCATCTACAGTCTGGACAGTACTCGAGTACTGTCCAGACTGTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-989s1c1
Sequence:CCGGGAGTCCTTGTGTCATCGTCATCTCGAGATGACGATGACACAAGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-623s1c1
Sequence:CCGGGAGGCCTTACTGCAGGAATTTCTCGAGAAATTCCTGCAGTAAGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-737s1c1
Sequence:CCGGGCCTTCTACTGCCGTTTGAAACTCGAGTTTCAAACGGCAGTAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026125
VALIDATED
FAM132A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 132, member A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-453s21c1
Sequence:CCGGTGCCCACATGACGTGGTTGAACTCGAGTTCAACCACGTCATGTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026125.2-683s21c1
Sequence:CCGGGGCTACCAGACACATTGTTACCTCGAGGTAACAATGTGTCTGGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-799s21c1
Sequence:CCGGGGATTCCAAGCTCCTACTACTCTCGAGAGTAGTAGGAGCTTGGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-338s21c1
Sequence:CCGGAGAAGTCTCGGCAGCTGTTTGCTCGAGCAAACAGCTGCCGAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-988s21c1
Sequence:CCGGGAGTCCTTGTGTCATCGTCATCTCGAGATGACGATGACACAAGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-736s21c1
Sequence:CCGGGCCTTCTACTGCCGTTTGAAACTCGAGTTTCAAACGGCAGTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026125.2-658s21c1
Sequence:CCGGGAGGCCACAGAACTTCGATTCCTCGAGGAATCGAAGTTCTGTGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-632s1c1
Sequence:CCGGCTGCAGGAATTTCAGGAGATACTCGAGTATCTCCTGAAATTCCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026125.1-1081s1c1
Sequence:CCGGGCATCTACAGTCTGGACAGTACTCGAGTACTGTCCAGACTGTAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-989s1c1
Sequence:CCGGGAGTCCTTGTGTCATCGTCATCTCGAGATGACGATGACACAAGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-623s1c1
Sequence:CCGGGAGGCCTTACTGCAGGAATTTCTCGAGAAATTCCTGCAGTAAGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026125.1-737s1c1
Sequence:CCGGGCCTTCTACTGCCGTTTGAAACTCGAGTTTCAAACGGCAGTAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014980
FAM132A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 132, member A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-856s21c1
Sequence:CCGGCTTCTGTGTTTGTGGACAATGCTCGAGCATTGTCCACAAACACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-720s21c1
Sequence:CCGGGTGTGTGTTCTCATCTGTATTCTCGAGAATACAGATGAGAACACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-247s21c1
Sequence:CCGGACATGACATGGCTGAACTTTGCTCGAGCAAAGTTCAGCCATGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-303s21c1
Sequence:CCGGTGCGGAAGCAGGGACAAGAAGCTCGAGCTTCTTGTCCCTGCTTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014980
FAM132A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 132, member A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-856s21c1
Sequence:CCGGCTTCTGTGTTTGTGGACAATGCTCGAGCATTGTCCACAAACACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-720s21c1
Sequence:CCGGGTGTGTGTTCTCATCTGTATTCTCGAGAATACAGATGAGAACACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-247s21c1
Sequence:CCGGACATGACATGGCTGAACTTTGCTCGAGCAAAGTTCAGCCATGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-303s21c1
Sequence:CCGGTGCGGAAGCAGGGACAAGAAGCTCGAGCTTCTTGTCCCTGCTTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014980
FAM132A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 132, member A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-856s21c1
Sequence:CCGGCTTCTGTGTTTGTGGACAATGCTCGAGCATTGTCCACAAACACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-720s21c1
Sequence:CCGGGTGTGTGTTCTCATCTGTATTCTCGAGAATACAGATGAGAACACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-247s21c1
Sequence:CCGGACATGACATGGCTGAACTTTGCTCGAGCAAAGTTCAGCCATGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014980.1-303s21c1
Sequence:CCGGTGCGGAAGCAGGGACAAGAAGCTCGAGCTTCTTGTCCCTGCTTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)