EMAIL THIS PAGE TO A FRIEND

FAM132B

family with sequence similarity 132, member B

58 Gene Product Result for
Synonyms: C1QTNF15 CTRP15
UniProtKB ID: Q4G0M1
Gene ID:
Mouse(227358) family with sequence similarity 132, member B
Rat(681056) family with sequence similarity 132, member B
cow(101905782) family with sequence similarity 132, member B
naked mole-rat(101701622) family with sequence similarity 132, member B
domestic guinea pig(100714137) family with sequence similarity 132, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA077259 Anti-FAM132B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001130886 Rosetta Predictions human pricing
XM_001714385 Rosetta Predictions human pricing
XM_001715780 Rosetta Predictions human pricing
XM_001060107 Rosetta Predictions rat pricing
NM_173395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001130886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00387766 predicted 1007
2 SASI_Hs02_00387767 predicted 971
3 SASI_Hs02_00387768 predicted 1064
4 SASI_Hs02_00387769 predicted 969
5 SASI_Hs02_00387770 predicted 301
6 SASI_Hs02_00387771 predicted 280
7 SASI_Hs02_00387772 predicted 701
8 SASI_Hs02_00387773 predicted 280
9 SASI_Hs02_00387774 predicted 711
10 SASI_Hs02_00387775 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396762 predicted 1011
2 SASI_Hs02_00396763 predicted 975
3 SASI_Hs02_00396764 predicted 1069
4 SASI_Hs02_00396765 predicted 967
5 SASI_Hs02_00396766 predicted 300
6 SASI_Hs02_00396767 predicted 280
7 SASI_Hs02_00396768 predicted 698
8 SASI_Hs02_00396769 predicted 274
9 SASI_Hs02_00396770 predicted 708
10 SASI_Hs02_00396771 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406065 predicted 242
2 SASI_Hs02_00406066 predicted 632
3 SASI_Hs02_00406067 predicted 316
4 SASI_Hs02_00406068 predicted 578
5 SASI_Hs02_00406069 predicted 320
6 SASI_Hs02_00406070 predicted 637
7 SASI_Hs02_00406071 predicted 543
8 SASI_Hs02_00406072 predicted 242
9 SASI_Hs02_00406073 predicted 555
10 SASI_Hs02_00406074 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295417 predicted 211
2 SASI_Rn02_00295418 predicted 233
3 SASI_Rn02_00295419 predicted 404
4 SASI_Rn02_00295420 predicted 369
5 SASI_Rn02_00295421 predicted 600
6 SASI_Rn02_00295422 predicted 674
7 SASI_Rn02_00295423 predicted 231
8 SASI_Rn02_00295424 predicted 367
9 SASI_Rn02_00295425 predicted 341
10 SASI_Rn02_00295426 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109376 predicted 469
2 SASI_Mm01_00109378 predicted 1145
3 SASI_Mm01_00109379 predicted 1231
4 SASI_Mm02_00345230 predicted 454
5 SASI_Mm01_00109380 predicted 1033
6 SASI_Mm01_00109381 predicted 1506
7 SASI_Mm01_00109382 predicted 1392
8 SASI_Mm01_00109383 predicted 1280
9 SASI_Mm01_00109384 predicted 1316
10 SASI_Mm01_00109385 predicted 681
11 SASI_Mm01_00109377 predicted 1304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173395
FAM132B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 132, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-360s1c1
Sequence:CCGGCCCTTTATCCCATCTGAGGTTCTCGAGAACCTCAGATGGGATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-245s1c1
Sequence:CCGGGTTCGTCAAGCAGAGTGACAACTCGAGTTGTCACTCTGCTTGACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-908s1c1
Sequence:CCGGGCTCTTCACCATCTCAGTAAACTCGAGTTTACTGAGATGGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-959s1c1
Sequence:CCGGCACTTCTGTCTTCTTGGACAACTCGAGTTGTCCAAGAAGACAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173395
FAM132B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 132, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-360s1c1
Sequence:CCGGCCCTTTATCCCATCTGAGGTTCTCGAGAACCTCAGATGGGATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-245s1c1
Sequence:CCGGGTTCGTCAAGCAGAGTGACAACTCGAGTTGTCACTCTGCTTGACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-908s1c1
Sequence:CCGGGCTCTTCACCATCTCAGTAAACTCGAGTTTACTGAGATGGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-959s1c1
Sequence:CCGGCACTTCTGTCTTCTTGGACAACTCGAGTTGTCCAAGAAGACAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173395
FAM132B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 132, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-360s1c1
Sequence:CCGGCCCTTTATCCCATCTGAGGTTCTCGAGAACCTCAGATGGGATAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-245s1c1
Sequence:CCGGGTTCGTCAAGCAGAGTGACAACTCGAGTTGTCACTCTGCTTGACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-908s1c1
Sequence:CCGGGCTCTTCACCATCTCAGTAAACTCGAGTTTACTGAGATGGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173395.1-959s1c1
Sequence:CCGGCACTTCTGTCTTCTTGGACAACTCGAGTTGTCCAAGAAGACAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks