EMAIL THIS PAGE TO A FRIEND

FAM133A

family with sequence similarity 133, member A

19 Gene Product Result for
Synonyms: CT115
UniProtKB ID: Q8N9E0
Gene ID:
cow(540188) family with sequence similarity 133, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173698 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025101 MISSION® esiRNA esiRNA human FAM133A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173698 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139533 predicted 1550
2 SASI_Hs01_00139534 predicted 1546
3 SASI_Hs01_00139535 predicted 1040
4 SASI_Hs01_00139536 predicted 1366
5 SASI_Hs01_00139538 predicted 1377
6 SASI_Hs01_00139539 predicted 1093
7 SASI_Hs01_00139540 predicted 1400
8 SASI_Hs01_00139541 predicted 940
9 SASI_Hs02_00368640 predicted 1177
10 SASI_Hs02_00368641 predicted 1349
11 SASI_Hs01_00139537 predicted 1127
12 SASI_Hs01_00139542 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173698
FAM133A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 133, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173698.1-2277s21c1
Sequence:CCGGGATCTTCCTGTGTCCGTATTTCTCGAGAAATACGGACACAGGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-367s21c1
Sequence:CCGGATGGAGAGGCCCAACTCAATCCTCGAGGATTGAGTTGGGCCTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-745s21c1
Sequence:CCGGCTCTACGCATGAATCAGAATCCTCGAGGATTCTGATTCATGCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-892s21c1
Sequence:CCGGGTCCTCATCTGAATCAGATTACTCGAGTAATCTGATTCAGATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-393s21c1
Sequence:CCGGGCCCAACAATCCAAGATTATCCTCGAGGATAATCTTGGATTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173698
FAM133A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 133, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173698.1-2277s21c1
Sequence:CCGGGATCTTCCTGTGTCCGTATTTCTCGAGAAATACGGACACAGGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-367s21c1
Sequence:CCGGATGGAGAGGCCCAACTCAATCCTCGAGGATTGAGTTGGGCCTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-745s21c1
Sequence:CCGGCTCTACGCATGAATCAGAATCCTCGAGGATTCTGATTCATGCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-892s21c1
Sequence:CCGGGTCCTCATCTGAATCAGATTACTCGAGTAATCTGATTCAGATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-393s21c1
Sequence:CCGGGCCCAACAATCCAAGATTATCCTCGAGGATAATCTTGGATTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173698
FAM133A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 133, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173698.1-2277s21c1
Sequence:CCGGGATCTTCCTGTGTCCGTATTTCTCGAGAAATACGGACACAGGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-367s21c1
Sequence:CCGGATGGAGAGGCCCAACTCAATCCTCGAGGATTGAGTTGGGCCTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-745s21c1
Sequence:CCGGCTCTACGCATGAATCAGAATCCTCGAGGATTCTGATTCATGCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-892s21c1
Sequence:CCGGGTCCTCATCTGAATCAGATTACTCGAGTAATCTGATTCAGATGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173698.1-393s21c1
Sequence:CCGGGCCCAACAATCCAAGATTATCCTCGAGGATAATCTTGGATTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks