EMAIL THIS PAGE TO A FRIEND

FAM133B

family with sequence similarity 133, member B

172 Gene Product Result for
UniProtKB ID: Q5BKY9, B2R994, Q05D67, Q6P5S6, Q8N0W8
Gene ID:
Mouse(68152) family with sequence similarity 133, member B
Rat(362320) family with sequence similarity 133, member B
Zebrafish(790942) family with sequence similarity 133, member B
cow(539475) family with sequence similarity 133, member B
chicken(420557) family with sequence similarity 133, member B
sheep(101112047) family with sequence similarity 133, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040057 Rosetta Predictions human pricing
NM_152789 Rosetta Predictions human pricing
NM_001024799 Rosetta Predictions rat pricing
NM_001042501 Rosetta Predictions mouse pricing
NM_026583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082254 predicted 1234
2 SASI_Hs01_00082256 predicted 1191
3 SASI_Hs01_00082258 predicted 1260
4 SASI_Hs01_00082259 predicted 1295
5 SASI_Hs01_00082255 predicted 1263
6 SASI_Hs02_00308776 predicted 289
7 SASI_Hs01_00082261 predicted 953
8 SASI_Hs01_00082262 predicted 988
9 SASI_Hs01_00082263 predicted 961
10 SASI_Hs02_00308777 predicted 596
11 SASI_Hs01_00082257 predicted 1149
12 SASI_Hs01_00082260 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133720 predicted 1137
2 SASI_Hs01_00133722 predicted 1090
3 SASI_Hs01_00133724 predicted 1156
4 SASI_Hs01_00133725 predicted 1201
5 SASI_Hs01_00133721 predicted 1171
6 SASI_Hs01_00133727 predicted 188
7 SASI_Hs02_00366736 predicted 853
8 SASI_Hs01_00133729 predicted 857
9 SASI_Hs02_00366737 predicted 122
10 SASI_Hs02_00366738 predicted 505
11 SASI_Hs01_00133723 predicted 1060
12 SASI_Hs01_00133726 predicted 1232
13 SASI_Hs01_00133728 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031666 predicted 1038
2 SASI_Rn01_00031672 predicted 1288
3 SASI_Rn01_00031668 predicted 1216
4 SASI_Rn01_00031669 predicted 1033
5 SASI_Rn01_00031671 predicted 1052
6 SASI_Rn02_00202722 predicted 1154
7 SASI_Rn01_00031673 predicted 589
8 SASI_Rn01_00031674 predicted 616
9 SASI_Rn01_00031675 predicted 168
10 SASI_Rn02_00202723 predicted 104
11 SASI_Rn01_00031667 predicted 1041
12 SASI_Rn01_00031670 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290465 predicted 1127
2 SASI_Mm02_00290466 predicted 1225
3 SASI_Mm02_00290467 predicted 1036
4 SASI_Mm02_00290468 predicted 1075
5 SASI_Mm02_00290469 predicted 1053
6 SASI_Mm02_00290470 predicted 1200
7 SASI_Mm02_00290471 predicted 1305
8 SASI_Mm02_00290472 predicted 1061
9 SASI_Mm02_00290473 predicted 179
10 SASI_Mm02_00290474 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103012 predicted 599
2 SASI_Mm01_00103013 predicted 168
3 SASI_Mm01_00103014 predicted 425
4 SASI_Mm01_00103015 predicted 662
5 SASI_Mm01_00103016 predicted 426
6 SASI_Mm01_00103017 predicted 102
7 SASI_Mm01_00103018 predicted 159
8 SASI_Mm01_00103019 predicted 571
9 SASI_Mm01_00103020 predicted 464
10 SASI_Mm01_00103021 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152789
FAM133B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 133, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152789.2-1133s21c1
Sequence:CCAGCTAGAAGCGTCTAAGGATAAACTCGAGTTTATCCTTAGACGCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152789.2-685s21c1
Sequence:CCGGTGTCAGAATCAGAGTATATTGCTCGAGCAATATACTCTGATTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152789.1-1927s1c1
Sequence:CCGGGCTGTGTCTTATTGCCAGAATCTCGAGATTCTGGCAATAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152789.1-459s1c1
Sequence:CCGGCCGTTCACATAAATCTTCTGACTCGAGTCAGAAGATTTATGTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-482s1c1
Sequence:CCGGGCTCCATGTCAGAAACTGAATCTCGAGATTCAGTTTCTGACATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-404s1c1
Sequence:CCGGCTGATTCTGAAGATGAGGATACTCGAGTATCCTCATCTTCAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152789.1-2072s1c1
Sequence:CCGGGCCTCATGTCTACTGCTGAATCTCGAGATTCAGCAGTAGACATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152789.1-1002s1c1
Sequence:CCGGGCTTGATAACTCTGGGAGATACTCGAGTATCTCCCAGAGTTATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-368s1c1
Sequence:CCGGCTTCTTCATCAAGCTCTGATTCTCGAGAATCAGAGCTTGATGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152789.1-497s1c1
Sequence:CCGGCTGAATCAGACAGTAAGGATACTCGAGTATCCTTACTGTCTGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152789
FAM133B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 133, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152789.2-1133s21c1
Sequence:CCAGCTAGAAGCGTCTAAGGATAAACTCGAGTTTATCCTTAGACGCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152789.2-685s21c1
Sequence:CCGGTGTCAGAATCAGAGTATATTGCTCGAGCAATATACTCTGATTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152789.1-1927s1c1
Sequence:CCGGGCTGTGTCTTATTGCCAGAATCTCGAGATTCTGGCAATAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152789.1-459s1c1
Sequence:CCGGCCGTTCACATAAATCTTCTGACTCGAGTCAGAAGATTTATGTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-482s1c1
Sequence:CCGGGCTCCATGTCAGAAACTGAATCTCGAGATTCAGTTTCTGACATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-404s1c1
Sequence:CCGGCTGATTCTGAAGATGAGGATACTCGAGTATCCTCATCTTCAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152789.1-2072s1c1
Sequence:CCGGGCCTCATGTCTACTGCTGAATCTCGAGATTCAGCAGTAGACATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152789.1-1002s1c1
Sequence:CCGGGCTTGATAACTCTGGGAGATACTCGAGTATCTCCCAGAGTTATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-368s1c1
Sequence:CCGGCTTCTTCATCAAGCTCTGATTCTCGAGAATCAGAGCTTGATGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152789.1-497s1c1
Sequence:CCGGCTGAATCAGACAGTAAGGATACTCGAGTATCCTTACTGTCTGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152789
FAM133B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 133, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152789.2-1133s21c1
Sequence:CCAGCTAGAAGCGTCTAAGGATAAACTCGAGTTTATCCTTAGACGCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152789.2-685s21c1
Sequence:CCGGTGTCAGAATCAGAGTATATTGCTCGAGCAATATACTCTGATTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152789.1-1927s1c1
Sequence:CCGGGCTGTGTCTTATTGCCAGAATCTCGAGATTCTGGCAATAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152789.1-459s1c1
Sequence:CCGGCCGTTCACATAAATCTTCTGACTCGAGTCAGAAGATTTATGTGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-482s1c1
Sequence:CCGGGCTCCATGTCAGAAACTGAATCTCGAGATTCAGTTTCTGACATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-404s1c1
Sequence:CCGGCTGATTCTGAAGATGAGGATACTCGAGTATCCTCATCTTCAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152789.1-2072s1c1
Sequence:CCGGGCCTCATGTCTACTGCTGAATCTCGAGATTCAGCAGTAGACATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152789.1-1002s1c1
Sequence:CCGGGCTTGATAACTCTGGGAGATACTCGAGTATCTCCCAGAGTTATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152789.1-368s1c1
Sequence:CCGGCTTCTTCATCAAGCTCTGATTCTCGAGAATCAGAGCTTGATGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152789.1-497s1c1
Sequence:CCGGCTGAATCAGACAGTAAGGATACTCGAGTATCCTTACTGTCTGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042501
VALIDATED
FAM133B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 133, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-642s21c1
Sequence:CCGGACGAAGATAAACCGTTGTCATCTCGAGATGACAACGGTTTATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-171s21c1
Sequence:CCGGGACCAACAATCCAGGATTATCCTCGAGGATAATCCTGGATTGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042501.1-384s21c1
Sequence:CCGGAGAAGAAATCTGGTAGGTATTCTCGAGAATACCTACCAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-449s21c1
Sequence:CCGGGATTCCGAAGATGAGGATAAACTCGAGTTTATCCTCATCTTCGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042501.1-1718s21c1
Sequence:CCGGTAGCCAGTGATAGATACTTTACTCGAGTAAAGTATCTATCACTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042501
VALIDATED
FAM133B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 133, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-642s21c1
Sequence:CCGGACGAAGATAAACCGTTGTCATCTCGAGATGACAACGGTTTATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-171s21c1
Sequence:CCGGGACCAACAATCCAGGATTATCCTCGAGGATAATCCTGGATTGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042501.1-384s21c1
Sequence:CCGGAGAAGAAATCTGGTAGGTATTCTCGAGAATACCTACCAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-449s21c1
Sequence:CCGGGATTCCGAAGATGAGGATAAACTCGAGTTTATCCTCATCTTCGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042501.1-1718s21c1
Sequence:CCGGTAGCCAGTGATAGATACTTTACTCGAGTAAAGTATCTATCACTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042501
VALIDATED
FAM133B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 133, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-642s21c1
Sequence:CCGGACGAAGATAAACCGTTGTCATCTCGAGATGACAACGGTTTATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-171s21c1
Sequence:CCGGGACCAACAATCCAGGATTATCCTCGAGGATAATCCTGGATTGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001042501.1-384s21c1
Sequence:CCGGAGAAGAAATCTGGTAGGTATTCTCGAGAATACCTACCAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042501.1-449s21c1
Sequence:CCGGGATTCCGAAGATGAGGATAAACTCGAGTTTATCCTCATCTTCGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042501.1-1718s21c1
Sequence:CCGGTAGCCAGTGATAGATACTTTACTCGAGTAAAGTATCTATCACTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks