EMAIL THIS PAGE TO A FRIEND

FAM134A

family with sequence similarity 134, member A

134 Gene Product Result for
Synonyms: C2orf17
UniProtKB ID: Q8NC44, Q6P1P5, Q9H0K7
Gene ID:
Mouse(227298) family with sequence similarity 134, member A
Rat(363252) family with sequence similarity 134, member A
Zebrafish(564232) family with sequence similarity 134, member A
chicken(424203) family with sequence similarity 134, member A
cow(507475) family with sequence similarity 134, member A
domestic cat(101094039) family with sequence similarity 134, member A
dog(488535) family with sequence similarity 134, member A
domestic guinea pig(100736176) family with sequence similarity 134, member A
naked mole-rat(101725766) family with sequence similarity 134, member A
sheep(101114421) family with sequence similarity 134, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024293 Rosetta Predictions human pricing
XM_001057799 Rosetta Predictions rat pricing
XM_343592 Rosetta Predictions rat pricing
NM_170755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197011 predicted 692
2 SASI_Hs01_00197012 predicted 810
3 SASI_Hs01_00197013 predicted 530
4 SASI_Hs01_00197014 predicted 681
5 SASI_Hs01_00197015 predicted 2146
6 SASI_Hs01_00197016 predicted 2154
7 SASI_Hs01_00197017 predicted 585
8 SASI_Hs01_00197019 predicted 849
9 SASI_Hs02_00356625 predicted 1069
10 SASI_Hs01_00197020 predicted 883
11 SASI_Hs01_00197018 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287595 predicted 612
2 SASI_Rn02_00287596 predicted 393
3 SASI_Rn02_00287597 predicted 1072
4 SASI_Rn02_00287598 predicted 689
5 SASI_Rn02_00287599 predicted 393
6 SASI_Rn02_00287600 predicted 1642
7 SASI_Rn02_00287601 predicted 473
8 SASI_Rn02_00287602 predicted 614
9 SASI_Rn02_00287603 predicted 673
10 SASI_Rn02_00287604 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396078 predicted 616
2 SASI_Rn02_00396079 predicted 394
3 SASI_Rn02_00396080 predicted 1069
4 SASI_Rn02_00396081 predicted 682
5 SASI_Rn02_00396082 predicted 398
6 SASI_Rn02_00396083 predicted 1634
7 SASI_Rn02_00396084 predicted 466
8 SASI_Rn02_00396085 predicted 610
9 SASI_Rn02_00396086 predicted 675
10 SASI_Rn02_00396087 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102795 predicted 656
2 SASI_Mm01_00102796 predicted 876
3 SASI_Mm02_00343598 predicted 2092
4 SASI_Mm01_00102803 predicted 454
5 SASI_Mm02_00343599 predicted 797
6 SASI_Mm02_00343600 predicted 2090
7 SASI_Mm02_00343601 predicted 1531
8 SASI_Mm02_00343602 predicted 985
9 SASI_Mm02_00343603 predicted 600
10 SASI_Mm02_00343604 predicted 797
11 SASI_Mm01_00102797 predicted 515
12 SASI_Mm01_00102798 predicted 1058
13 SASI_Mm01_00102799 predicted 938
14 SASI_Mm01_00102800 predicted 600
15 SASI_Mm01_00102801 predicted 778
16 SASI_Mm01_00102802 predicted 1210
17 SASI_Mm01_00102804 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024293
VALIDATED
FAM134A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 134, member A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024293.2-724s1c1
Sequence:CCGGGACACTATGTTCCAGGGATTACTCGAGTAATCCCTGGAACATAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-2147s1c1
Sequence:CCGGGTTGTTTAGTTGAGGCACTTTCTCGAGAAAGTGCCTCAACTAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024293.2-2184s1c1
Sequence:CCGGCTTGTGTTCCTTTCTGCTTTACTCGAGTAAAGCAGAAAGGAACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-751s1c1
Sequence:CCGGCCTACATTGTCTTGTTGAGTACTCGAGTACTCAACAAGACAATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1697s1c1
Sequence:CCGGCGACATCCATTCTCTGGTACACTCGAGTGTACCAGAGAATGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1065s1c1
Sequence:CCGGGCTTCTATCTTGGAGAGTGGTCTCGAGACCACTCTCCAAGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024293.2-1590s1c1
Sequence:CCGGGAGGACTTTGAGTTGCTGGATCTCGAGATCCAGCAACTCAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1340s1c1
Sequence:CCGGCTTTGTGAACACGCACTTCAACTCGAGTTGAAGTGCGTGTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1079s21c1
Sequence:CCGGGCTTCTATCTTGGAGAGTGGTCTCGAGACCACTCTCCAAGATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024293.4-2161s21c1
Sequence:CCGGGTTGTTTAGTTGAGGCACTTTCTCGAGAAAGTGCCTCAACTAAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1711s21c1
Sequence:CCGGCGACATCCATTCTCTGGTACACTCGAGTGTACCAGAGAATGGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1354s21c1
Sequence:CCGGCTTTGTGAACACGCACTTCAACTCGAGTTGAAGTGCGTGTTCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-765s21c1
Sequence:CCGGCCTACATTGTCTTGTTGAGTACTCGAGTACTCAACAAGACAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024293
VALIDATED
FAM134A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 134, member A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024293.2-724s1c1
Sequence:CCGGGACACTATGTTCCAGGGATTACTCGAGTAATCCCTGGAACATAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-2147s1c1
Sequence:CCGGGTTGTTTAGTTGAGGCACTTTCTCGAGAAAGTGCCTCAACTAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024293.2-2184s1c1
Sequence:CCGGCTTGTGTTCCTTTCTGCTTTACTCGAGTAAAGCAGAAAGGAACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-751s1c1
Sequence:CCGGCCTACATTGTCTTGTTGAGTACTCGAGTACTCAACAAGACAATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1697s1c1
Sequence:CCGGCGACATCCATTCTCTGGTACACTCGAGTGTACCAGAGAATGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1065s1c1
Sequence:CCGGGCTTCTATCTTGGAGAGTGGTCTCGAGACCACTCTCCAAGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024293.2-1590s1c1
Sequence:CCGGGAGGACTTTGAGTTGCTGGATCTCGAGATCCAGCAACTCAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1340s1c1
Sequence:CCGGCTTTGTGAACACGCACTTCAACTCGAGTTGAAGTGCGTGTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1079s21c1
Sequence:CCGGGCTTCTATCTTGGAGAGTGGTCTCGAGACCACTCTCCAAGATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024293.4-2161s21c1
Sequence:CCGGGTTGTTTAGTTGAGGCACTTTCTCGAGAAAGTGCCTCAACTAAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1711s21c1
Sequence:CCGGCGACATCCATTCTCTGGTACACTCGAGTGTACCAGAGAATGGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1354s21c1
Sequence:CCGGCTTTGTGAACACGCACTTCAACTCGAGTTGAAGTGCGTGTTCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-765s21c1
Sequence:CCGGCCTACATTGTCTTGTTGAGTACTCGAGTACTCAACAAGACAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024293
VALIDATED
FAM134A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 134, member A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024293.2-724s1c1
Sequence:CCGGGACACTATGTTCCAGGGATTACTCGAGTAATCCCTGGAACATAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147351    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-2147s1c1
Sequence:CCGGGTTGTTTAGTTGAGGCACTTTCTCGAGAAAGTGCCTCAACTAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024293.2-2184s1c1
Sequence:CCGGCTTGTGTTCCTTTCTGCTTTACTCGAGTAAAGCAGAAAGGAACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-751s1c1
Sequence:CCGGCCTACATTGTCTTGTTGAGTACTCGAGTACTCAACAAGACAATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1697s1c1
Sequence:CCGGCGACATCCATTCTCTGGTACACTCGAGTGTACCAGAGAATGGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1065s1c1
Sequence:CCGGGCTTCTATCTTGGAGAGTGGTCTCGAGACCACTCTCCAAGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024293.2-1590s1c1
Sequence:CCGGGAGGACTTTGAGTTGCTGGATCTCGAGATCCAGCAACTCAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024293.2-1340s1c1
Sequence:CCGGCTTTGTGAACACGCACTTCAACTCGAGTTGAAGTGCGTGTTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1079s21c1
Sequence:CCGGGCTTCTATCTTGGAGAGTGGTCTCGAGACCACTCTCCAAGATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024293.4-2161s21c1
Sequence:CCGGGTTGTTTAGTTGAGGCACTTTCTCGAGAAAGTGCCTCAACTAAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1711s21c1
Sequence:CCGGCGACATCCATTCTCTGGTACACTCGAGTGTACCAGAGAATGGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-1354s21c1
Sequence:CCGGCTTTGTGAACACGCACTTCAACTCGAGTTGAAGTGCGTGTTCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024293.4-765s21c1
Sequence:CCGGCCTACATTGTCTTGTTGAGTACTCGAGTACTCAACAAGACAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170755
VALIDATED
FAM134A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 134, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-427s1c1
Sequence:CCGGCCTCGCTTTCTCCCTGACGTTCTCGAGAACGTCAGGGAGAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-742s1c1
Sequence:CCGGGAGTTGATCCAGAGGATGTATCTCGAGATACATCCTCTGGATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-666s1c1
Sequence:CCGGACACTATGTTCCGGGAGTTATCTCGAGATAACTCCCGGAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-665s1c1
Sequence:CCGGGACACTATGTTCCGGGAGTTACTCGAGTAACTCCCGGAACATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-1411s1c1
Sequence:CCGGCCCAACTTTGCCTTGCTGAAACTCGAGTTTCAGCAAGGCAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-664s21c2
Sequence:CCGGGACACTATGTTCCGGGAGTTACTCGAGTAACTCCCGGAACATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-741s21c2
Sequence:CCGGGAGTTGATCCAGAGGATGTATCTCGAGATACATCCTCTGGATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-665s21c1
Sequence:CCGGACACTATGTTCCGGGAGTTATCTCGAGATAACTCCCGGAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-1408s21c1
Sequence:CCGGCCCAACTTTGCCTTGCTGAAACTCGAGTTTCAGCAAGGCAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-426s21c3
Sequence:CCGGCCTCGCTTTCTCCCTGACGTTCTCGAGAACGTCAGGGAGAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170755
VALIDATED
FAM134A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 134, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-427s1c1
Sequence:CCGGCCTCGCTTTCTCCCTGACGTTCTCGAGAACGTCAGGGAGAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-742s1c1
Sequence:CCGGGAGTTGATCCAGAGGATGTATCTCGAGATACATCCTCTGGATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-666s1c1
Sequence:CCGGACACTATGTTCCGGGAGTTATCTCGAGATAACTCCCGGAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-665s1c1
Sequence:CCGGGACACTATGTTCCGGGAGTTACTCGAGTAACTCCCGGAACATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-1411s1c1
Sequence:CCGGCCCAACTTTGCCTTGCTGAAACTCGAGTTTCAGCAAGGCAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-664s21c2
Sequence:CCGGGACACTATGTTCCGGGAGTTACTCGAGTAACTCCCGGAACATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-741s21c2
Sequence:CCGGGAGTTGATCCAGAGGATGTATCTCGAGATACATCCTCTGGATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-665s21c1
Sequence:CCGGACACTATGTTCCGGGAGTTATCTCGAGATAACTCCCGGAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-1408s21c1
Sequence:CCGGCCCAACTTTGCCTTGCTGAAACTCGAGTTTCAGCAAGGCAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-426s21c3
Sequence:CCGGCCTCGCTTTCTCCCTGACGTTCTCGAGAACGTCAGGGAGAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170755
VALIDATED
FAM134A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 134, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-427s1c1
Sequence:CCGGCCTCGCTTTCTCCCTGACGTTCTCGAGAACGTCAGGGAGAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-742s1c1
Sequence:CCGGGAGTTGATCCAGAGGATGTATCTCGAGATACATCCTCTGGATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-666s1c1
Sequence:CCGGACACTATGTTCCGGGAGTTATCTCGAGATAACTCCCGGAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-665s1c1
Sequence:CCGGGACACTATGTTCCGGGAGTTACTCGAGTAACTCCCGGAACATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170755.1-1411s1c1
Sequence:CCGGCCCAACTTTGCCTTGCTGAAACTCGAGTTTCAGCAAGGCAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-664s21c2
Sequence:CCGGGACACTATGTTCCGGGAGTTACTCGAGTAACTCCCGGAACATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-741s21c2
Sequence:CCGGGAGTTGATCCAGAGGATGTATCTCGAGATACATCCTCTGGATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-665s21c1
Sequence:CCGGACACTATGTTCCGGGAGTTATCTCGAGATAACTCCCGGAACATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-1408s21c1
Sequence:CCGGCCCAACTTTGCCTTGCTGAAACTCGAGTTTCAGCAAGGCAAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170755.2-426s21c3
Sequence:CCGGCCTCGCTTTCTCCCTGACGTTCTCGAGAACGTCAGGGAGAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks