EMAIL THIS PAGE TO A FRIEND

FAM134B

family with sequence similarity 134, member B

131 Gene Product Result for
Synonyms: JK-1 JK1
UniProtKB ID: Q9H6L5, Q69YN8, Q9H6K6, Q9H764, Q9NXM8
Gene ID:
Human(54463) Summary: The protein encoded by this gene is a cis-Golgi transmembrane protein that may be necessary for the long-term survival of nociceptive and autonomic ganglion neurons. Mutations in this gene are a cause of hereditary sensory and autonomic neuropathy type IIB (HSAN IIB), and this gene may also play a role in susceptibility to vascular dementia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(66270) family with sequence similarity 134, member B
Rat(619558) family with sequence similarity 134, member B
sheep(101120110) family with sequence similarity 134, member B
naked mole-rat(101702162) family with sequence similarity 134, member B
domestic guinea pig(100720866) family with sequence similarity 134, member B
cow(540068) family with sequence similarity 134, member B
dog(479382) family with sequence similarity 134, member B
domestic cat(101089243) family with sequence similarity 134, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034850 Rosetta Predictions human pricing
NM_019000 Rosetta Predictions human pricing
NM_001034912 Rosetta Predictions rat pricing
NM_001034851 Rosetta Predictions mouse pricing
NM_025459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308149 predicted 861
2 SASI_Hs01_00172421 predicted 835
3 SASI_Hs01_00172422 predicted 863
4 SASI_Hs01_00172423 predicted 975
5 SASI_Hs01_00172424 predicted 1241
6 SASI_Hs01_00172426 predicted 819
7 SASI_Hs02_00308150 predicted 829
8 SASI_Hs01_00172427 predicted 696
9 SASI_Hs01_00172428 predicted 1000
10 SASI_Hs01_00172429 predicted 933
11 SASI_Hs01_00172425 predicted 996
12 SASI_Hs01_00172430 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352510 predicted 715
2 SASI_Hs01_00035005 predicted 681
3 SASI_Hs01_00035006 predicted 711
4 SASI_Hs01_00035007 predicted 823
5 SASI_Hs01_00035008 predicted 1091
6 SASI_Hs01_00035010 predicted 669
7 SASI_Hs02_00352511 predicted 680
8 SASI_Hs01_00035011 predicted 540
9 SASI_Hs01_00035012 predicted 850
10 SASI_Hs01_00035013 predicted 776
11 SASI_Hs01_00035009 predicted 851
12 SASI_Hs01_00035014 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122257 predicted 766
2 SASI_Rn01_00122258 predicted 482
3 SASI_Rn01_00122259 predicted 1293
4 SASI_Rn02_00204048 predicted 1164
5 SASI_Rn01_00122262 predicted 765
6 SASI_Rn01_00122263 predicted 380
7 SASI_Rn01_00122264 predicted 694
8 SASI_Rn01_00122265 predicted 411
9 SASI_Rn01_00122266 predicted 1108
10 SASI_Rn02_00204049 predicted 722
11 SASI_Rn01_00122260 predicted 485
12 SASI_Rn01_00122261 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129085 predicted 905
2 SASI_Mm01_00129086 predicted 759
3 SASI_Mm01_00129087 predicted 1054
4 SASI_Mm01_00129088 predicted 1159
5 SASI_Mm01_00129089 predicted 857
6 SASI_Mm01_00129090 predicted 953
7 SASI_Mm01_00129091 predicted 1280
8 SASI_Mm01_00129092 predicted 1235
9 SASI_Mm01_00129093 predicted 925
10 SASI_Mm01_00129094 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071573 predicted 605
2 SASI_Mm01_00071574 predicted 455
3 SASI_Mm01_00071575 predicted 743
4 SASI_Mm01_00071576 predicted 859
5 SASI_Mm01_00071577 predicted 552
6 SASI_Mm01_00071578 predicted 649
7 SASI_Mm01_00071579 predicted 975
8 SASI_Mm01_00071580 predicted 924
9 SASI_Mm01_00071581 predicted 615
10 SASI_Mm01_00071582 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019000
VALIDATED
FAM134B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 134, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019000.3-1589s21c1
Sequence:CCGGTAAGCATGGAAATGAACTTTACTCGAGTAAAGTTCATTTCCATGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-400s21c1
Sequence:CCGGTGCAGAATCATGGATGAATTTCTCGAGAAATTCATCCATGATTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-1042s21c1
Sequence:CCGGACCAAGCAAAGAGACGCAATCCTCGAGGATTGCGTCTCTTTGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-510s21c1
Sequence:CCGGCGATCTTGGGAAGTTACATTCCTCGAGGAATGTAACTTCCCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-815s21c1
Sequence:CCGGGAGGTATCCTGGACTGATAATCTCGAGATTATCAGTCCAGGATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-1060s1c1
Sequence:CCGGGCAGCTATCAAAGACCAGTTACTCGAGTAACTGGTCTTTGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-457s1c1
Sequence:CCGGCTACTGTTACTGTGTGCATTTCTCGAGAAATGCACACAGTAACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-772s1c1
Sequence:CCGGCCACAGACAGACACTTCTGATCTCGAGATCAGAAGTGTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019000.2-661s1c1
Sequence:CCGGCCTAAGATTAGCCTCACGGTTCTCGAGAACCGTGAGGCTAATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019000.2-1248s1c1
Sequence:CCGGGTCTTCAGGTTTCCTTTCAAACTCGAGTTTGAAAGGAAACCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019000
VALIDATED
FAM134B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 134, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019000.3-1589s21c1
Sequence:CCGGTAAGCATGGAAATGAACTTTACTCGAGTAAAGTTCATTTCCATGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-400s21c1
Sequence:CCGGTGCAGAATCATGGATGAATTTCTCGAGAAATTCATCCATGATTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-1042s21c1
Sequence:CCGGACCAAGCAAAGAGACGCAATCCTCGAGGATTGCGTCTCTTTGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-510s21c1
Sequence:CCGGCGATCTTGGGAAGTTACATTCCTCGAGGAATGTAACTTCCCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-815s21c1
Sequence:CCGGGAGGTATCCTGGACTGATAATCTCGAGATTATCAGTCCAGGATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-1060s1c1
Sequence:CCGGGCAGCTATCAAAGACCAGTTACTCGAGTAACTGGTCTTTGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-457s1c1
Sequence:CCGGCTACTGTTACTGTGTGCATTTCTCGAGAAATGCACACAGTAACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-772s1c1
Sequence:CCGGCCACAGACAGACACTTCTGATCTCGAGATCAGAAGTGTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019000.2-661s1c1
Sequence:CCGGCCTAAGATTAGCCTCACGGTTCTCGAGAACCGTGAGGCTAATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019000.2-1248s1c1
Sequence:CCGGGTCTTCAGGTTTCCTTTCAAACTCGAGTTTGAAAGGAAACCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019000
VALIDATED
FAM134B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 134, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019000.3-1589s21c1
Sequence:CCGGTAAGCATGGAAATGAACTTTACTCGAGTAAAGTTCATTTCCATGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-400s21c1
Sequence:CCGGTGCAGAATCATGGATGAATTTCTCGAGAAATTCATCCATGATTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-1042s21c1
Sequence:CCGGACCAAGCAAAGAGACGCAATCCTCGAGGATTGCGTCTCTTTGCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-510s21c1
Sequence:CCGGCGATCTTGGGAAGTTACATTCCTCGAGGAATGTAACTTCCCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019000.3-815s21c1
Sequence:CCGGGAGGTATCCTGGACTGATAATCTCGAGATTATCAGTCCAGGATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-1060s1c1
Sequence:CCGGGCAGCTATCAAAGACCAGTTACTCGAGTAACTGGTCTTTGATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-457s1c1
Sequence:CCGGCTACTGTTACTGTGTGCATTTCTCGAGAAATGCACACAGTAACAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_019000.2-772s1c1
Sequence:CCGGCCACAGACAGACACTTCTGATCTCGAGATCAGAAGTGTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019000.2-661s1c1
Sequence:CCGGCCTAAGATTAGCCTCACGGTTCTCGAGAACCGTGAGGCTAATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019000.2-1248s1c1
Sequence:CCGGGTCTTCAGGTTTCCTTTCAAACTCGAGTTTGAAAGGAAACCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025459
VALIDATED
FAM134B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 134, member B
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-258s1c1
Sequence:CCGGCAGCATGTTTCTTCAAGAAATCTCGAGATTTCTTGAAGAAACATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-1102s1c1
Sequence:CCGGCAGGCAGAGCTAGATCAAATTCTCGAGAATTTGATCTAGCTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-179s1c1
Sequence:CCGGGAAGCTGGGAAGTCATCAATTCTCGAGAATTGATGACTTCCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-381s21c1
Sequence:CCGGCAGCTACCTTCTGTTACTGTTCTCGAGAACAGTAACAGAAGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-459s21c1
Sequence:CCGGAGTCAAGTCCATTCTATTAAACTCGAGTTTAATAGAATGGACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025459.2-553s21c1
Sequence:CCGGCACAAGGATGACAGTGAATTACTCGAGTAATTCACTGTCATCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-347s21c1
Sequence:CCGGCAATCTTGGGAAGTTACATTCCTCGAGGAATGTAACTTCCCAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-553s1c1
Sequence:CCGGCACAAGGATGACAGTGAATTACTCGAGTAATTCACTGTCATCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-381s1c1
Sequence:CCGGCAGCTACCTTCTGTTACTGTTCTCGAGAACAGTAACAGAAGGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-234s1c1
Sequence:CCGGCATTGCAGAATCATGGATGAACTCGAGTTCATCCATGATTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-811s1c1
Sequence:CCGGGATGAATTAAGCCTGGGCTTACTCGAGTAAGCCCAGGCTTAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-592s1c1
Sequence:CCGGCCTAAGATTAGCCTCACAGTTCTCGAGAACTGTGAGGCTAATCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-581s1c1
Sequence:CCGGCAGCTCTTTGTCCTAAGATTACTCGAGTAATCTTAGGACAAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025459
VALIDATED
FAM134B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 134, member B
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-258s1c1
Sequence:CCGGCAGCATGTTTCTTCAAGAAATCTCGAGATTTCTTGAAGAAACATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-1102s1c1
Sequence:CCGGCAGGCAGAGCTAGATCAAATTCTCGAGAATTTGATCTAGCTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-179s1c1
Sequence:CCGGGAAGCTGGGAAGTCATCAATTCTCGAGAATTGATGACTTCCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-381s21c1
Sequence:CCGGCAGCTACCTTCTGTTACTGTTCTCGAGAACAGTAACAGAAGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-459s21c1
Sequence:CCGGAGTCAAGTCCATTCTATTAAACTCGAGTTTAATAGAATGGACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025459.2-553s21c1
Sequence:CCGGCACAAGGATGACAGTGAATTACTCGAGTAATTCACTGTCATCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-347s21c1
Sequence:CCGGCAATCTTGGGAAGTTACATTCCTCGAGGAATGTAACTTCCCAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-553s1c1
Sequence:CCGGCACAAGGATGACAGTGAATTACTCGAGTAATTCACTGTCATCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-381s1c1
Sequence:CCGGCAGCTACCTTCTGTTACTGTTCTCGAGAACAGTAACAGAAGGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-234s1c1
Sequence:CCGGCATTGCAGAATCATGGATGAACTCGAGTTCATCCATGATTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-811s1c1
Sequence:CCGGGATGAATTAAGCCTGGGCTTACTCGAGTAAGCCCAGGCTTAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-592s1c1
Sequence:CCGGCCTAAGATTAGCCTCACAGTTCTCGAGAACTGTGAGGCTAATCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-581s1c1
Sequence:CCGGCAGCTCTTTGTCCTAAGATTACTCGAGTAATCTTAGGACAAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025459
VALIDATED
FAM134B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 134, member B
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-258s1c1
Sequence:CCGGCAGCATGTTTCTTCAAGAAATCTCGAGATTTCTTGAAGAAACATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-1102s1c1
Sequence:CCGGCAGGCAGAGCTAGATCAAATTCTCGAGAATTTGATCTAGCTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-179s1c1
Sequence:CCGGGAAGCTGGGAAGTCATCAATTCTCGAGAATTGATGACTTCCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-381s21c1
Sequence:CCGGCAGCTACCTTCTGTTACTGTTCTCGAGAACAGTAACAGAAGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-459s21c1
Sequence:CCGGAGTCAAGTCCATTCTATTAAACTCGAGTTTAATAGAATGGACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025459.2-553s21c1
Sequence:CCGGCACAAGGATGACAGTGAATTACTCGAGTAATTCACTGTCATCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025459.2-347s21c1
Sequence:CCGGCAATCTTGGGAAGTTACATTCCTCGAGGAATGTAACTTCCCAAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-553s1c1
Sequence:CCGGCACAAGGATGACAGTGAATTACTCGAGTAATTCACTGTCATCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-381s1c1
Sequence:CCGGCAGCTACCTTCTGTTACTGTTCTCGAGAACAGTAACAGAAGGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-234s1c1
Sequence:CCGGCATTGCAGAATCATGGATGAACTCGAGTTCATCCATGATTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025459.2-811s1c1
Sequence:CCGGGATGAATTAAGCCTGGGCTTACTCGAGTAAGCCCAGGCTTAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-592s1c1
Sequence:CCGGCCTAAGATTAGCCTCACAGTTCTCGAGAACTGTGAGGCTAATCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025459.2-581s1c1
Sequence:CCGGCAGCTCTTTGTCCTAAGATTACTCGAGTAATCTTAGGACAAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks