EMAIL THIS PAGE TO A FRIEND

FAM134C

family with sequence similarity 134, member C

76 Gene Product Result for
UniProtKB ID: Q86VR2
Gene ID:
Mouse(67998) family with sequence similarity 134, member C
Rat(360632) family with sequence similarity 134, member C
Zebrafish(566014) family with sequence similarity 134, member C
cow(789163) family with sequence similarity 134, member C
dog(490964) family with sequence similarity 134, member C
domestic cat(101098668) family with sequence similarity 134, member C
chicken(772215) family with sequence similarity 134, member C
domestic guinea pig(100719590) family with sequence similarity 134, member C
naked mole-rat(101716433) family with sequence similarity 134, member C
sheep(101104510) family with sequence similarity 134, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016492 Anti-FAM134C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100754 Anti-FAM134C antibody produced in rabbit affinity isolated antibody canine, horse, human, bovine, mouse, rat, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178126 Rosetta Predictions human pricing
XM_001081450 Rosetta Predictions rat pricing
XM_001081451 Rosetta Predictions rat pricing
XM_340907 Rosetta Predictions rat pricing
NM_026501 Rosetta Predictions mouse pricing
NM_028933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055950 predicted 924
2 SASI_Hs01_00055951 predicted 886
3 SASI_Hs01_00055952 predicted 936
4 SASI_Hs01_00055953 predicted 1048
5 SASI_Hs01_00055954 predicted 967
6 SASI_Hs01_00055955 predicted 999
7 SASI_Hs01_00055956 predicted 995
8 SASI_Hs01_00055958 predicted 779
9 SASI_Hs01_00055959 predicted 633
10 SASI_Hs02_00369535 predicted 332
11 SASI_Hs01_00055957 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371956 predicted 1567
2 SASI_Rn02_00371957 predicted 549
3 SASI_Rn02_00371958 predicted 931
4 SASI_Rn02_00371959 predicted 916
5 SASI_Rn02_00371960 predicted 803
6 SASI_Rn02_00371961 predicted 1090
7 SASI_Rn02_00371962 predicted 802
8 SASI_Rn02_00371963 predicted 1551
9 SASI_Rn02_00371964 predicted 1564
10 SASI_Rn02_00371965 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371966 predicted 677
2 SASI_Rn02_00371967 predicted 1057
3 SASI_Rn02_00371968 predicted 1032
4 SASI_Rn02_00371969 predicted 1044
5 SASI_Rn02_00371970 predicted 928
6 SASI_Rn02_00371971 predicted 1220
7 SASI_Rn02_00371972 predicted 933
8 SASI_Rn02_00371973 predicted 1036
9 SASI_Rn02_00371974 predicted 380
10 SASI_Rn02_00371975 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392090 predicted 680
2 SASI_Rn02_00392091 predicted 1051
3 SASI_Rn02_00392092 predicted 1037
4 SASI_Rn02_00392093 predicted 1038
5 SASI_Rn02_00392094 predicted 929
6 SASI_Rn02_00392095 predicted 1224
7 SASI_Rn02_00392096 predicted 928
8 SASI_Rn02_00392097 predicted 1038
9 SASI_Rn02_00392098 predicted 379
10 SASI_Rn02_00392099 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184170 predicted 1615
2 SASI_Mm01_00184171 predicted 1844
3 SASI_Mm01_00184172 predicted 996
4 SASI_Mm01_00184173 predicted 869
5 SASI_Mm01_00184174 predicted 1577
6 SASI_Mm01_00184175 predicted 1163
7 SASI_Mm01_00184176 predicted 878
8 SASI_Mm01_00184177 predicted 884
9 SASI_Mm02_00330396 predicted 932
10 SASI_Mm01_00184178 predicted 1615
11 SASI_Mm01_00184169 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172340 predicted 1507
2 SASI_Mm01_00172341 predicted 1730
3 SASI_Mm01_00172342 predicted 888
4 SASI_Mm01_00172343 predicted 761
5 SASI_Mm01_00172344 predicted 1473
6 SASI_Mm01_00172345 predicted 1052
7 SASI_Mm01_00172346 predicted 761
8 SASI_Mm01_00172347 predicted 778
9 SASI_Mm02_00334637 predicted 829
10 SASI_Mm01_00172348 predicted 1511
11 SASI_Mm01_00172339 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026501
VALIDATED
FAM134C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 134, member C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.1-1048s1c1
Sequence:CCGGCCTTCCATTAACGTGGATCCTCTCGAGAGGATCCACGTTAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.2-326s1c1
Sequence:CCGGCATTCAGCTTGATGATCATTGCTCGAGCAATGATCATCAAGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.2-627s1c1
Sequence:CCGGCTTGATGCTTGTCATCATTATCTCGAGATAATGATGACAAGCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-2742s21c1
Sequence:CCGGTGTGAAAGTTAGGCATAATAACTCGAGTTATTATGCCTAACTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-326s21c1
Sequence:CCGGCATTCAGCTTGATGATCATTGCTCGAGCAATGATCATCAAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-1201s21c1
Sequence:CCGGTCCCTTCCTGGAGGATCTAACCTCGAGGTTAGATCCTCCAGGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-485s21c1
Sequence:CCGGTCTGGGTTAGTGGGACCATTTCTCGAGAAATGGTCCCACTAACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-1003s21c1
Sequence:CCGGAGTGATCCAGAGGAGTCATTTCTCGAGAAATGACTCCTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026501
VALIDATED
FAM134C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 134, member C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.1-1048s1c1
Sequence:CCGGCCTTCCATTAACGTGGATCCTCTCGAGAGGATCCACGTTAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.2-326s1c1
Sequence:CCGGCATTCAGCTTGATGATCATTGCTCGAGCAATGATCATCAAGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.2-627s1c1
Sequence:CCGGCTTGATGCTTGTCATCATTATCTCGAGATAATGATGACAAGCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-2742s21c1
Sequence:CCGGTGTGAAAGTTAGGCATAATAACTCGAGTTATTATGCCTAACTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-326s21c1
Sequence:CCGGCATTCAGCTTGATGATCATTGCTCGAGCAATGATCATCAAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-1201s21c1
Sequence:CCGGTCCCTTCCTGGAGGATCTAACCTCGAGGTTAGATCCTCCAGGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-485s21c1
Sequence:CCGGTCTGGGTTAGTGGGACCATTTCTCGAGAAATGGTCCCACTAACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-1003s21c1
Sequence:CCGGAGTGATCCAGAGGAGTCATTTCTCGAGAAATGACTCCTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026501
VALIDATED
FAM134C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 134, member C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.1-1048s1c1
Sequence:CCGGCCTTCCATTAACGTGGATCCTCTCGAGAGGATCCACGTTAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.2-326s1c1
Sequence:CCGGCATTCAGCTTGATGATCATTGCTCGAGCAATGATCATCAAGCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026501.2-627s1c1
Sequence:CCGGCTTGATGCTTGTCATCATTATCTCGAGATAATGATGACAAGCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-2742s21c1
Sequence:CCGGTGTGAAAGTTAGGCATAATAACTCGAGTTATTATGCCTAACTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-326s21c1
Sequence:CCGGCATTCAGCTTGATGATCATTGCTCGAGCAATGATCATCAAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-1201s21c1
Sequence:CCGGTCCCTTCCTGGAGGATCTAACCTCGAGGTTAGATCCTCCAGGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-485s21c1
Sequence:CCGGTCTGGGTTAGTGGGACCATTTCTCGAGAAATGGTCCCACTAACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026501.2-1003s21c1
Sequence:CCGGAGTGATCCAGAGGAGTCATTTCTCGAGAAATGACTCCTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178126
VALIDATED
FAM134C MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 134, member C
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178126.2-340s1c1
Sequence:CCGGGCATTTGGCTTGATGATCATTCTCGAGAATGATCATCAAGCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178126.2-768s1c1
Sequence:CCGGCAAGCAGAGAGAGAGACAATTCTCGAGAATTGTCTCTCTCTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-868s1c1
Sequence:CCGGCAGCTGGACGATTCTACTGTTCTCGAGAACAGTAGAATCGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178126.2-767s1c1
Sequence:CCGGCCAAGCAGAGAGAGAGACAATCTCGAGATTGTCTCTCTCTCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-938s1c1
Sequence:CCGGCCTGTACAGACAATGGCACATCTCGAGATGTGCCATTGTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-309s1c1
Sequence:CCGGCCTGACATCTCTTCGTCTTGTCTCGAGACAAGACGAAGAGATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178126.2-1030s1c1
Sequence:CCGGGAATCCTTTGCCAGAGACCTTCTCGAGAAGGTCTCTGGCAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-868s21c1
Sequence:CCGGCAGCTGGACGATTCTACTGTTCTCGAGAACAGTAGAATCGTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-309s21c1
Sequence:CCGGCCTGACATCTCTTCGTCTTGTCTCGAGACAAGACGAAGAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-938s21c1
Sequence:CCGGCCTGTACAGACAATGGCACATCTCGAGATGTGCCATTGTCTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-340s21c1
Sequence:CCGGGCATTTGGCTTGATGATCATTCTCGAGAATGATCATCAAGCCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178126
VALIDATED
FAM134C MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 134, member C
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178126.2-340s1c1
Sequence:CCGGGCATTTGGCTTGATGATCATTCTCGAGAATGATCATCAAGCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178126.2-768s1c1
Sequence:CCGGCAAGCAGAGAGAGAGACAATTCTCGAGAATTGTCTCTCTCTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-868s1c1
Sequence:CCGGCAGCTGGACGATTCTACTGTTCTCGAGAACAGTAGAATCGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178126.2-767s1c1
Sequence:CCGGCCAAGCAGAGAGAGAGACAATCTCGAGATTGTCTCTCTCTCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-938s1c1
Sequence:CCGGCCTGTACAGACAATGGCACATCTCGAGATGTGCCATTGTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-309s1c1
Sequence:CCGGCCTGACATCTCTTCGTCTTGTCTCGAGACAAGACGAAGAGATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178126.2-1030s1c1
Sequence:CCGGGAATCCTTTGCCAGAGACCTTCTCGAGAAGGTCTCTGGCAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-868s21c1
Sequence:CCGGCAGCTGGACGATTCTACTGTTCTCGAGAACAGTAGAATCGTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-309s21c1
Sequence:CCGGCCTGACATCTCTTCGTCTTGTCTCGAGACAAGACGAAGAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-938s21c1
Sequence:CCGGCCTGTACAGACAATGGCACATCTCGAGATGTGCCATTGTCTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-340s21c1
Sequence:CCGGGCATTTGGCTTGATGATCATTCTCGAGAATGATCATCAAGCCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178126
VALIDATED
FAM134C MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 134, member C
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178126.2-340s1c1
Sequence:CCGGGCATTTGGCTTGATGATCATTCTCGAGAATGATCATCAAGCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178126.2-768s1c1
Sequence:CCGGCAAGCAGAGAGAGAGACAATTCTCGAGAATTGTCTCTCTCTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-868s1c1
Sequence:CCGGCAGCTGGACGATTCTACTGTTCTCGAGAACAGTAGAATCGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178126.2-767s1c1
Sequence:CCGGCCAAGCAGAGAGAGAGACAATCTCGAGATTGTCTCTCTCTCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-938s1c1
Sequence:CCGGCCTGTACAGACAATGGCACATCTCGAGATGTGCCATTGTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_178126.2-309s1c1
Sequence:CCGGCCTGACATCTCTTCGTCTTGTCTCGAGACAAGACGAAGAGATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178126.2-1030s1c1
Sequence:CCGGGAATCCTTTGCCAGAGACCTTCTCGAGAAGGTCTCTGGCAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-868s21c1
Sequence:CCGGCAGCTGGACGATTCTACTGTTCTCGAGAACAGTAGAATCGTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-309s21c1
Sequence:CCGGCCTGACATCTCTTCGTCTTGTCTCGAGACAAGACGAAGAGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-938s21c1
Sequence:CCGGCCTGTACAGACAATGGCACATCTCGAGATGTGCCATTGTCTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178126.2-340s21c1
Sequence:CCGGGCATTTGGCTTGATGATCATTCTCGAGAATGATCATCAAGCCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks