EMAIL THIS PAGE TO A FRIEND

FAM135A

family with sequence similarity 135, member A

168 Gene Product Result for
Synonyms: KIAA1411
Gene ID:
Mouse(68187) family with sequence similarity 135, member A
Rat(367235) family with sequence similarity 135, member A
sheep(101108058) family with sequence similarity 135, member A
naked mole-rat(101710170) family with sequence similarity 135, member A
domestic guinea pig(100724139) family with sequence similarity 135, member A
Zebrafish(449938) family with sequence similarity 135, member A
cow(532081) family with sequence similarity 135, member A
domestic cat(101086652) family with sequence similarity 135, member A
dog(474960) family with sequence similarity 135, member A
chicken(421871) family with sequence similarity 135, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105531 Rosetta Predictions human pricing
NM_020819 Rosetta Predictions human pricing
NM_001134597 Rosetta Predictions rat pricing
NM_026604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324231 predicted 3331
2 SASI_Hs02_00324232 predicted 1911
3 SASI_Hs02_00324233 predicted 4290
4 SASI_Hs02_00324234 predicted 4147
5 SASI_Hs02_00324235 predicted 2508
6 SASI_Hs02_00324236 predicted 1756
7 SASI_Hs02_00324237 predicted 1034
8 SASI_Hs02_00324238 predicted 1077
9 SASI_Hs02_00324239 predicted 2022
10 SASI_Hs02_00324240 predicted 2401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354023 predicted 3195
2 SASI_Hs02_00354024 predicted 1773
3 SASI_Hs02_00354025 predicted 4152
4 SASI_Hs02_00354026 predicted 4010
5 SASI_Hs02_00354027 predicted 2374
6 SASI_Hs02_00354028 predicted 1616
7 SASI_Hs01_00045201 predicted 815
8 SASI_Hs02_00354029 predicted 862
9 SASI_Hs01_00045202 predicted 1881
10 SASI_Hs01_00045205 predicted 2264
11 SASI_Hs01_00045199 predicted 976
12 SASI_Hs01_00045200 predicted 3604
13 SASI_Hs01_00045203 predicted 1391
14 SASI_Hs01_00045204 predicted 3192
15 SASI_Hs01_00045206 predicted 3073
16 SASI_Hs01_00045207 predicted 2158
17 SASI_Hs01_00045208 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257449 predicted 4256
2 SASI_Rn02_00257450 predicted 1743
3 SASI_Rn02_00257451 predicted 1291
4 SASI_Rn02_00257452 predicted 2398
5 SASI_Rn02_00257453 predicted 2212
6 SASI_Rn02_00257454 predicted 562
7 SASI_Rn02_00257455 predicted 869
8 SASI_Rn02_00257456 predicted 4622
9 SASI_Rn02_00257457 predicted 4112
10 SASI_Rn02_00257458 predicted 4493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156714 predicted 2327
2 SASI_Mm01_00156715 predicted 4176
3 SASI_Mm01_00156716 predicted 4033
4 SASI_Mm01_00156717 predicted 2373
5 SASI_Mm01_00156718 predicted 1682
6 SASI_Mm01_00156720 predicted 481
7 SASI_Mm01_00156721 predicted 2437
8 SASI_Mm02_00330567 predicted 3764
9 SASI_Mm01_00156722 predicted 613
10 SASI_Mm02_00330568 predicted 2191
11 SASI_Mm01_00156719 predicted 1206
12 SASI_Mm01_00156723 predicted 4407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020819
VALIDATED
FAM135A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 135, member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-1585s21c1
Sequence:CCGGCTCAATTCATTACCTATAATCCTCGAGGATTATAGGTAATGAATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-683s21c1
Sequence:CCGGTGAATGCCTTGCAACTAATAACTCGAGTTATTAGTTGCAAGGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-2265s21c1
Sequence:CCGGTGAGAGTACAAGTGCTATAAGCTCGAGCTTATAGCACTTGTACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-3767s21c1
Sequence:CCGGGACATTCGTTGGGCAATTTAACTCGAGTTAAATTGCCCAACGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-1402s21c1
Sequence:CCGGACTTTGAGGGTACGCAGATTTCTCGAGAAATCTGCGTACCCTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-3106s1c1
Sequence:CCGGCCACGAGAGTCTCCTTGTAATCTCGAGATTACAAGGAGACTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020819.2-1711s1c1
Sequence:CCGGCCCAACTTTGAGTCCTTAGAACTCGAGTTCTAAGGACTCAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-3928s1c1
Sequence:CCGGGCCCGCATTGAAATGTGTAAACTCGAGTTTACACATTTCAATGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-4906s1c1
Sequence:CCGGGCCTTGATTTGGTTGGAATTTCTCGAGAAATTCCAACCAAATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-4111s1c1
Sequence:CCGGGCTGTTCTTGATTCGGAAATACTCGAGTATTTCCGAATCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020819.2-4438s1c1
Sequence:CCGGCAGTGAAACTTTAAGCCCATACTCGAGTATGGGCTTAAAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020819
VALIDATED
FAM135A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 135, member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-1585s21c1
Sequence:CCGGCTCAATTCATTACCTATAATCCTCGAGGATTATAGGTAATGAATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-683s21c1
Sequence:CCGGTGAATGCCTTGCAACTAATAACTCGAGTTATTAGTTGCAAGGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-2265s21c1
Sequence:CCGGTGAGAGTACAAGTGCTATAAGCTCGAGCTTATAGCACTTGTACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-3767s21c1
Sequence:CCGGGACATTCGTTGGGCAATTTAACTCGAGTTAAATTGCCCAACGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-1402s21c1
Sequence:CCGGACTTTGAGGGTACGCAGATTTCTCGAGAAATCTGCGTACCCTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-3106s1c1
Sequence:CCGGCCACGAGAGTCTCCTTGTAATCTCGAGATTACAAGGAGACTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020819.2-1711s1c1
Sequence:CCGGCCCAACTTTGAGTCCTTAGAACTCGAGTTCTAAGGACTCAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-3928s1c1
Sequence:CCGGGCCCGCATTGAAATGTGTAAACTCGAGTTTACACATTTCAATGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-4906s1c1
Sequence:CCGGGCCTTGATTTGGTTGGAATTTCTCGAGAAATTCCAACCAAATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-4111s1c1
Sequence:CCGGGCTGTTCTTGATTCGGAAATACTCGAGTATTTCCGAATCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020819.2-4438s1c1
Sequence:CCGGCAGTGAAACTTTAAGCCCATACTCGAGTATGGGCTTAAAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020819
VALIDATED
FAM135A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 135, member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-1585s21c1
Sequence:CCGGCTCAATTCATTACCTATAATCCTCGAGGATTATAGGTAATGAATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-683s21c1
Sequence:CCGGTGAATGCCTTGCAACTAATAACTCGAGTTATTAGTTGCAAGGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-2265s21c1
Sequence:CCGGTGAGAGTACAAGTGCTATAAGCTCGAGCTTATAGCACTTGTACTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-3767s21c1
Sequence:CCGGGACATTCGTTGGGCAATTTAACTCGAGTTAAATTGCCCAACGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020819.4-1402s21c1
Sequence:CCGGACTTTGAGGGTACGCAGATTTCTCGAGAAATCTGCGTACCCTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-3106s1c1
Sequence:CCGGCCACGAGAGTCTCCTTGTAATCTCGAGATTACAAGGAGACTCTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020819.2-1711s1c1
Sequence:CCGGCCCAACTTTGAGTCCTTAGAACTCGAGTTCTAAGGACTCAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-3928s1c1
Sequence:CCGGGCCCGCATTGAAATGTGTAAACTCGAGTTTACACATTTCAATGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-4906s1c1
Sequence:CCGGGCCTTGATTTGGTTGGAATTTCTCGAGAAATTCCAACCAAATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020819.2-4111s1c1
Sequence:CCGGGCTGTTCTTGATTCGGAAATACTCGAGTATTTCCGAATCAAGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020819.2-4438s1c1
Sequence:CCGGCAGTGAAACTTTAAGCCCATACTCGAGTATGGGCTTAAAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026604
VALIDATED
FAM135A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 135, member A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-5234s21c1
Sequence:CCGGGATCCTTATTCAGACTATATCCTCGAGGATATAGTCTGAATAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026604.3-4689s1c1
Sequence:CCGGGATGCTAAGTTTATGACATATCTCGAGATATGTCATAAACTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-4915s21c1
Sequence:CCGGCGATCCTTATTCAGACTATATCTCGAGATATAGTCTGAATAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-2336s21c1
Sequence:CCGGGTAAGTAGTGACACGATTAAACTCGAGTTTAATCGTGTCACTACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-474s21c1
Sequence:CCGGTGAATGCCTTGCAACTAATAACTCGAGTTATTAGTTGCAAGGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-4041s21c1
Sequence:CCGGGACATTCGTTAGGCAATTTAACTCGAGTTAAATTGCCTAACGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-2655s21c1
Sequence:CCGGTAAGTAGTGACACGATTAAATCTCGAGATTTAATCGTGTCACTACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-1037s21c1
Sequence:CCGGAGTGTAGTCTTTGGTATTAACCTCGAGGTTAATACCAAAGACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-1433s21c1
Sequence:CCGGACTTTGAGGGTTCGCAGATTTCTCGAGAAATCTGCGAACCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-933s21c1
Sequence:CCGGCACTACACCAGCCGCTAATAACTCGAGTTATTAGCGGCTGGTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-1602s1c1
Sequence:CCGGCCTCATTTGGATGCTCCCTTTCTCGAGAAAGGGAGCATCCAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-592s1c1
Sequence:CCGGGCCTAAATCTTTGTGCAAATTCTCGAGAATTTGCACAAAGATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-667s1c1
Sequence:CCGGCGGAACACAATCTGGCATCTACTCGAGTAGATGCCAGATTGTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026604
VALIDATED
FAM135A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 135, member A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-5234s21c1
Sequence:CCGGGATCCTTATTCAGACTATATCCTCGAGGATATAGTCTGAATAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026604.3-4689s1c1
Sequence:CCGGGATGCTAAGTTTATGACATATCTCGAGATATGTCATAAACTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-4915s21c1
Sequence:CCGGCGATCCTTATTCAGACTATATCTCGAGATATAGTCTGAATAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-2336s21c1
Sequence:CCGGGTAAGTAGTGACACGATTAAACTCGAGTTTAATCGTGTCACTACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-474s21c1
Sequence:CCGGTGAATGCCTTGCAACTAATAACTCGAGTTATTAGTTGCAAGGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-4041s21c1
Sequence:CCGGGACATTCGTTAGGCAATTTAACTCGAGTTAAATTGCCTAACGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-2655s21c1
Sequence:CCGGTAAGTAGTGACACGATTAAATCTCGAGATTTAATCGTGTCACTACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-1037s21c1
Sequence:CCGGAGTGTAGTCTTTGGTATTAACCTCGAGGTTAATACCAAAGACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-1433s21c1
Sequence:CCGGACTTTGAGGGTTCGCAGATTTCTCGAGAAATCTGCGAACCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-933s21c1
Sequence:CCGGCACTACACCAGCCGCTAATAACTCGAGTTATTAGCGGCTGGTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-1602s1c1
Sequence:CCGGCCTCATTTGGATGCTCCCTTTCTCGAGAAAGGGAGCATCCAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-592s1c1
Sequence:CCGGGCCTAAATCTTTGTGCAAATTCTCGAGAATTTGCACAAAGATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-667s1c1
Sequence:CCGGCGGAACACAATCTGGCATCTACTCGAGTAGATGCCAGATTGTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026604
VALIDATED
FAM135A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 135, member A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-5234s21c1
Sequence:CCGGGATCCTTATTCAGACTATATCCTCGAGGATATAGTCTGAATAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026604.3-4689s1c1
Sequence:CCGGGATGCTAAGTTTATGACATATCTCGAGATATGTCATAAACTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-4915s21c1
Sequence:CCGGCGATCCTTATTCAGACTATATCTCGAGATATAGTCTGAATAAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-2336s21c1
Sequence:CCGGGTAAGTAGTGACACGATTAAACTCGAGTTTAATCGTGTCACTACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-474s21c1
Sequence:CCGGTGAATGCCTTGCAACTAATAACTCGAGTTATTAGTTGCAAGGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.3-4041s21c1
Sequence:CCGGGACATTCGTTAGGCAATTTAACTCGAGTTAAATTGCCTAACGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-2655s21c1
Sequence:CCGGTAAGTAGTGACACGATTAAATCTCGAGATTTAATCGTGTCACTACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-1037s21c1
Sequence:CCGGAGTGTAGTCTTTGGTATTAACCTCGAGGTTAATACCAAAGACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-1433s21c1
Sequence:CCGGACTTTGAGGGTTCGCAGATTTCTCGAGAAATCTGCGAACCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026604.4-933s21c1
Sequence:CCGGCACTACACCAGCCGCTAATAACTCGAGTTATTAGCGGCTGGTGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-1602s1c1
Sequence:CCGGCCTCATTTGGATGCTCCCTTTCTCGAGAAAGGGAGCATCCAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-592s1c1
Sequence:CCGGGCCTAAATCTTTGTGCAAATTCTCGAGAATTTGCACAAAGATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026604.2-667s1c1
Sequence:CCGGCGGAACACAATCTGGCATCTACTCGAGTAGATGCCAGATTGTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks