EMAIL THIS PAGE TO A FRIEND

FAM135B

family with sequence similarity 135, member B

197 Gene Product Result for
Synonyms: C8ORFK32
UniProtKB ID: Q49AJ0, B5MDB3, O95879, Q2WGJ7, Q3KP46
Gene ID:
Mouse(70363) family with sequence similarity 135, member B
Rat(315069) family with sequence similarity 135, member B
chicken(428384) family with sequence similarity 135, member B
cow(618755) family with sequence similarity 135, member B
domestic cat(101095154) family with sequence similarity 135, member B
dog(482054) family with sequence similarity 135, member B
domestic guinea pig(100726490) family with sequence similarity 135, member B
naked mole-rat(101716543) family with sequence similarity 135, member B
sheep(101122366) family with sequence similarity 135, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015912 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015912 Rosetta Predictions human pricing
XM_001072719 Rosetta Predictions rat pricing
XM_235409 Rosetta Predictions rat pricing
NM_027401 Rosetta Predictions mouse pricing
NM_177819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348519 predicted 339
2 SASI_Hs02_00348520 predicted 399
3 SASI_Hs01_00220517 predicted 2843
4 SASI_Hs02_00348521 predicted 759
5 SASI_Hs01_00220519 predicted 2778
6 SASI_Hs02_00348522 predicted 3960
7 SASI_Hs02_00348523 predicted 3508
8 SASI_Hs01_00220521 predicted 3074
9 SASI_Hs02_00348524 predicted 4117
10 SASI_Hs01_00220522 predicted 3252
11 SASI_Hs01_00220518 predicted 488
12 SASI_Hs01_00220520 predicted 355
13 SASI_Hs01_00220523 predicted 775
14 SASI_Hs01_00220524 predicted 816
15 SASI_Hs01_00220525 predicted 1091
16 SASI_Hs01_00220526 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340258 predicted 1294
2 SASI_Rn02_00340259 predicted 2728
3 SASI_Rn02_00340260 predicted 3560
4 SASI_Rn02_00340261 predicted 1984
5 SASI_Rn02_00340262 predicted 2902
6 SASI_Rn02_00340263 predicted 767
7 SASI_Rn02_00340264 predicted 4148
8 SASI_Rn02_00340265 predicted 1117
9 SASI_Rn02_00340266 predicted 2615
10 SASI_Rn02_00340267 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389278 predicted 1449
2 SASI_Rn02_00389279 predicted 2882
3 SASI_Rn02_00389280 predicted 3720
4 SASI_Rn02_00389281 predicted 2139
5 SASI_Rn02_00389282 predicted 343
6 SASI_Rn02_00389283 predicted 3051
7 SASI_Rn02_00389284 predicted 916
8 SASI_Rn02_00389285 predicted 4302
9 SASI_Rn02_00389286 predicted 1272
10 SASI_Rn02_00389287 predicted 2767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050709 predicted 1251
2 SASI_Mm01_00050710 predicted 751
3 SASI_Mm01_00050711 predicted 770
4 SASI_Mm01_00050712 predicted 1126
5 SASI_Mm01_00050713 predicted 911
6 SASI_Mm01_00050714 predicted 621
7 SASI_Mm01_00050715 predicted 922
8 SASI_Mm01_00050716 predicted 681
9 SASI_Mm01_00050717 predicted 396
10 SASI_Mm01_00050718 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183540 predicted 476
2 SASI_Mm01_00183541 predicted 1056
3 SASI_Mm01_00183542 predicted 414
4 SASI_Mm01_00183543 predicted 491
5 SASI_Mm01_00183544 predicted 940
6 SASI_Mm01_00183545 predicted 421
7 SASI_Mm01_00183546 predicted 846
8 SASI_Mm01_00183547 predicted 954
9 SASI_Mm01_00183548 predicted 250
10 SASI_Mm01_00183549 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027401
FAM135B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 135, member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.1-1065s1c1
Sequence:CCGGGCCAGTGTATGCAGAAATGATCTCGAGATCATTTCTGCATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027401.1-1309s1c1
Sequence:CCGGCTCAAGATCATTTGAGTTCTTCTCGAGAAGAACTCAAATGATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-403s1c1
Sequence:CCGGCTAGCTTCTGACATACCATATCTCGAGATATGGTATGTCAGAAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-586s1c1
Sequence:CCGGCAGACGGATACATTTGCAGATCTCGAGATCTGCAAATGTATCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-680s1c1
Sequence:CCGGGAATTAGCTTCATCGGCCATTCTCGAGAATGGCCGATGAAGCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.2-1125s1c1
Sequence:CCGGCACTTTGATCAGACATAATGTCTCGAGACATTATGTCTGATCAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.2-898s1c1
Sequence:CCGGGATAATGCTGATCTGCGCAAACTCGAGTTTGCGCAGATCAGCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027401
FAM135B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 135, member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.1-1065s1c1
Sequence:CCGGGCCAGTGTATGCAGAAATGATCTCGAGATCATTTCTGCATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027401.1-1309s1c1
Sequence:CCGGCTCAAGATCATTTGAGTTCTTCTCGAGAAGAACTCAAATGATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-403s1c1
Sequence:CCGGCTAGCTTCTGACATACCATATCTCGAGATATGGTATGTCAGAAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-586s1c1
Sequence:CCGGCAGACGGATACATTTGCAGATCTCGAGATCTGCAAATGTATCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-680s1c1
Sequence:CCGGGAATTAGCTTCATCGGCCATTCTCGAGAATGGCCGATGAAGCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.2-1125s1c1
Sequence:CCGGCACTTTGATCAGACATAATGTCTCGAGACATTATGTCTGATCAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.2-898s1c1
Sequence:CCGGGATAATGCTGATCTGCGCAAACTCGAGTTTGCGCAGATCAGCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027401
FAM135B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 135, member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.1-1065s1c1
Sequence:CCGGGCCAGTGTATGCAGAAATGATCTCGAGATCATTTCTGCATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027401.1-1309s1c1
Sequence:CCGGCTCAAGATCATTTGAGTTCTTCTCGAGAAGAACTCAAATGATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-403s1c1
Sequence:CCGGCTAGCTTCTGACATACCATATCTCGAGATATGGTATGTCAGAAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-586s1c1
Sequence:CCGGCAGACGGATACATTTGCAGATCTCGAGATCTGCAAATGTATCCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027401.1-680s1c1
Sequence:CCGGGAATTAGCTTCATCGGCCATTCTCGAGAATGGCCGATGAAGCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.2-1125s1c1
Sequence:CCGGCACTTTGATCAGACATAATGTCTCGAGACATTATGTCTGATCAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027401.2-898s1c1
Sequence:CCGGGATAATGCTGATCTGCGCAAACTCGAGTTTGCGCAGATCAGCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177819
FAM135B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 135, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-955s1c1
Sequence:CCGGCCGACTCTATTTCCTGGTCATCTCGAGATGACCAGGAAATAGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177819.2-1260s1c1
Sequence:CCGGCCAAGAGGTGTCTATGGCATACTCGAGTATGCCATAGACACCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-1050s1c1
Sequence:CCGGGCTCAGAGTTACAGGTAATTACTCGAGTAATTACCTGTAACTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177819.2-1503s1c1
Sequence:CCGGCGAGCAAGACAAAGCTATCTTCTCGAGAAGATAGCTTTGTCTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-1084s1c1
Sequence:CCGGGAGTCTGAACAGATGGAAGTACTCGAGTACTTCCATCTGTTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177819
FAM135B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 135, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-955s1c1
Sequence:CCGGCCGACTCTATTTCCTGGTCATCTCGAGATGACCAGGAAATAGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177819.2-1260s1c1
Sequence:CCGGCCAAGAGGTGTCTATGGCATACTCGAGTATGCCATAGACACCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-1050s1c1
Sequence:CCGGGCTCAGAGTTACAGGTAATTACTCGAGTAATTACCTGTAACTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177819.2-1503s1c1
Sequence:CCGGCGAGCAAGACAAAGCTATCTTCTCGAGAAGATAGCTTTGTCTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-1084s1c1
Sequence:CCGGGAGTCTGAACAGATGGAAGTACTCGAGTACTTCCATCTGTTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177819
FAM135B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 135, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-955s1c1
Sequence:CCGGCCGACTCTATTTCCTGGTCATCTCGAGATGACCAGGAAATAGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177819.2-1260s1c1
Sequence:CCGGCCAAGAGGTGTCTATGGCATACTCGAGTATGCCATAGACACCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-1050s1c1
Sequence:CCGGGCTCAGAGTTACAGGTAATTACTCGAGTAATTACCTGTAACTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177819.2-1503s1c1
Sequence:CCGGCGAGCAAGACAAAGCTATCTTCTCGAGAAGATAGCTTTGTCTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177819.2-1084s1c1
Sequence:CCGGGAGTCTGAACAGATGGAAGTACTCGAGTACTTCCATCTGTTCAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015912
FAM135B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 135, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015912.2-1292s1c1
Sequence:CCGGCGGCTGGTAAAGACTTTCATACTCGAGTATGAAAGTCTTTACCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-652s1c1
Sequence:CCGGCCTAAAGACTTGAATGTGGGTCTCGAGACCCACATTCAAGTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015912.2-1398s1c1
Sequence:CCGGCGGATCGGTTATTGGATGAAACTCGAGTTTCATCCAATAACCGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015912.2-1366s1c1
Sequence:CCGGGATGGACACATTTGCAGATTTCTCGAGAAATCTGCAAATGTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-545s1c1
Sequence:CCGGGTGTTGAAACCAAAGGTCTTACTCGAGTAAGACCTTTGGTTTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-1138s1c1
Sequence:CCGGCCTTTGGGATCCTTTGGAGTTCTCGAGAACTCCAAAGGATCCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015912.3-1548s21c1
Sequence:CCGGCCTTGTCTTGTCTACCATAAACTCGAGTTTATGGTAGACAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015912.3-3528s21c1
Sequence:CCGGAGCTTCTGATATACCATATTTCTCGAGAAATATGGTATATCAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015912
FAM135B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 135, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015912.2-1292s1c1
Sequence:CCGGCGGCTGGTAAAGACTTTCATACTCGAGTATGAAAGTCTTTACCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-652s1c1
Sequence:CCGGCCTAAAGACTTGAATGTGGGTCTCGAGACCCACATTCAAGTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015912.2-1398s1c1
Sequence:CCGGCGGATCGGTTATTGGATGAAACTCGAGTTTCATCCAATAACCGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015912.2-1366s1c1
Sequence:CCGGGATGGACACATTTGCAGATTTCTCGAGAAATCTGCAAATGTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-545s1c1
Sequence:CCGGGTGTTGAAACCAAAGGTCTTACTCGAGTAAGACCTTTGGTTTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-1138s1c1
Sequence:CCGGCCTTTGGGATCCTTTGGAGTTCTCGAGAACTCCAAAGGATCCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015912.3-1548s21c1
Sequence:CCGGCCTTGTCTTGTCTACCATAAACTCGAGTTTATGGTAGACAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015912.3-3528s21c1
Sequence:CCGGAGCTTCTGATATACCATATTTCTCGAGAAATATGGTATATCAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015912
FAM135B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 135, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015912.2-1292s1c1
Sequence:CCGGCGGCTGGTAAAGACTTTCATACTCGAGTATGAAAGTCTTTACCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-652s1c1
Sequence:CCGGCCTAAAGACTTGAATGTGGGTCTCGAGACCCACATTCAAGTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015912.2-1398s1c1
Sequence:CCGGCGGATCGGTTATTGGATGAAACTCGAGTTTCATCCAATAACCGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015912.2-1366s1c1
Sequence:CCGGGATGGACACATTTGCAGATTTCTCGAGAAATCTGCAAATGTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-545s1c1
Sequence:CCGGGTGTTGAAACCAAAGGTCTTACTCGAGTAAGACCTTTGGTTTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015912.2-1138s1c1
Sequence:CCGGCCTTTGGGATCCTTTGGAGTTCTCGAGAACTCCAAAGGATCCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015912.3-1548s21c1
Sequence:CCGGCCTTGTCTTGTCTACCATAAACTCGAGTTTATGGTAGACAAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015912.3-3528s21c1
Sequence:CCGGAGCTTCTGATATACCATATTTCTCGAGAAATATGGTATATCAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks