EMAIL THIS PAGE TO A FRIEND

FAM136A

family with sequence similarity 136, member A

141 Gene Product Result for
UniProtKB ID: Q96C01, Q96SS3
Gene ID:
Mouse(66488) family with sequence similarity 136, member A
Rat(297415) family with sequence similarity 136, member A
naked mole-rat(101724316) family with sequence similarity 136, member A
domestic guinea pig(100724843) family with sequence similarity 136, member A
Zebrafish(406709) family with sequence similarity 136, member A
chicken(771344) family with sequence similarity 136, member A
cow(616997) family with sequence similarity 136, member A
domestic cat(101097139) family with sequence similarity 136, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032822 Rosetta Predictions human pricing
NM_001106605 Rosetta Predictions rat pricing
NM_025591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194076 predicted 662
2 SASI_Hs01_00194078 predicted 663
3 SASI_Hs01_00194080 predicted 775
4 SASI_Hs01_00194081 predicted 582
5 SASI_Hs02_00360411 predicted 838
6 SASI_Hs02_00360412 predicted 602
7 SASI_Hs01_00194073 predicted 595
8 SASI_Hs02_00360413 predicted 403
9 SASI_Hs02_00360414 predicted 861
10 SASI_Hs02_00360415 predicted 866
11 SASI_Hs01_00194074 predicted 337
12 SASI_Hs01_00194075 predicted 398
13 SASI_Hs01_00194077 predicted 344
14 SASI_Hs01_00194079 predicted 321
15 SASI_Hs01_00194082 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220598 predicted 511
2 SASI_Rn02_00220599 predicted 704
3 SASI_Rn02_00220600 predicted 493
4 SASI_Rn02_00220601 predicted 622
5 SASI_Rn02_00220602 predicted 604
6 SASI_Rn02_00220603 predicted 588
7 SASI_Rn02_00220604 predicted 683
8 SASI_Rn02_00220605 predicted 651
9 SASI_Rn02_00220606 predicted 337
10 SASI_Rn02_00220607 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124902 predicted 606
2 SASI_Mm01_00124903 predicted 650
3 SASI_Mm01_00124904 predicted 604
4 SASI_Mm02_00328584 predicted 506
5 SASI_Mm02_00328585 predicted 517
6 SASI_Mm01_00124905 predicted 672
7 SASI_Mm01_00124906 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032822
VALIDATED
FAM136A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 136, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-693s21c1
Sequence:CCGGTAAATCGAGTCAGAGATATTACTCGAGTAATATCTCTGACTCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-949s21c1
Sequence:CCGGTCAATGAGGTCACTAACTTAGCTCGAGCTAAGTTAGTGACCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032822.2-815s21c1
Sequence:CCGGTCTTACTACACAGGTACTAACCTCGAGGTTAGTACCTGTGTAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032822.2-458s21c1
Sequence:CCGGGAAGATGAAGGAGGCTCTCTTCTCGAGAAGAGAGCCTCCTTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-138s21c1
Sequence:CCGGGAAAGAGAGAACATCCGGAAGCTCGAGCTTCCGGATGTTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032822.1-102s1c1
Sequence:CCGGCCATGGTGAAGAGTCTGGAAACTCGAGTTTCCAGACTCTTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032822.1-310s1c1
Sequence:CCGGGCATTGCAATGACAAAGCCAACTCGAGTTGGCTTTGTCATTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-1455s1c1
Sequence:CCGGCCTGAATTAACAGAGCCCAATCTCGAGATTGGGCTCTGTTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-439s1c1
Sequence:CCGGGAAGATGAAGGAGGCTCTCTTCTCGAGAAGAGAGCCTCCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-119s1c1
Sequence:CCGGGAAAGAGAGAACATCCGGAAGCTCGAGCTTCCGGATGTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032822
VALIDATED
FAM136A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 136, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-693s21c1
Sequence:CCGGTAAATCGAGTCAGAGATATTACTCGAGTAATATCTCTGACTCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-949s21c1
Sequence:CCGGTCAATGAGGTCACTAACTTAGCTCGAGCTAAGTTAGTGACCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032822.2-815s21c1
Sequence:CCGGTCTTACTACACAGGTACTAACCTCGAGGTTAGTACCTGTGTAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032822.2-458s21c1
Sequence:CCGGGAAGATGAAGGAGGCTCTCTTCTCGAGAAGAGAGCCTCCTTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-138s21c1
Sequence:CCGGGAAAGAGAGAACATCCGGAAGCTCGAGCTTCCGGATGTTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032822.1-102s1c1
Sequence:CCGGCCATGGTGAAGAGTCTGGAAACTCGAGTTTCCAGACTCTTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032822.1-310s1c1
Sequence:CCGGGCATTGCAATGACAAAGCCAACTCGAGTTGGCTTTGTCATTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-1455s1c1
Sequence:CCGGCCTGAATTAACAGAGCCCAATCTCGAGATTGGGCTCTGTTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-439s1c1
Sequence:CCGGGAAGATGAAGGAGGCTCTCTTCTCGAGAAGAGAGCCTCCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-119s1c1
Sequence:CCGGGAAAGAGAGAACATCCGGAAGCTCGAGCTTCCGGATGTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032822
VALIDATED
FAM136A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 136, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-693s21c1
Sequence:CCGGTAAATCGAGTCAGAGATATTACTCGAGTAATATCTCTGACTCGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-949s21c1
Sequence:CCGGTCAATGAGGTCACTAACTTAGCTCGAGCTAAGTTAGTGACCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032822.2-815s21c1
Sequence:CCGGTCTTACTACACAGGTACTAACCTCGAGGTTAGTACCTGTGTAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032822.2-458s21c1
Sequence:CCGGGAAGATGAAGGAGGCTCTCTTCTCGAGAAGAGAGCCTCCTTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032822.2-138s21c1
Sequence:CCGGGAAAGAGAGAACATCCGGAAGCTCGAGCTTCCGGATGTTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032822.1-102s1c1
Sequence:CCGGCCATGGTGAAGAGTCTGGAAACTCGAGTTTCCAGACTCTTCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032822.1-310s1c1
Sequence:CCGGGCATTGCAATGACAAAGCCAACTCGAGTTGGCTTTGTCATTGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-1455s1c1
Sequence:CCGGCCTGAATTAACAGAGCCCAATCTCGAGATTGGGCTCTGTTAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-439s1c1
Sequence:CCGGGAAGATGAAGGAGGCTCTCTTCTCGAGAAGAGAGCCTCCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032822.1-119s1c1
Sequence:CCGGGAAAGAGAGAACATCCGGAAGCTCGAGCTTCCGGATGTTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025591
VALIDATED
FAM136A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 136, member A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-298s21c1
Sequence:CCGGCCATGCATTGCAATGACAAAGCTCGAGCTTTGTCATTGCAATGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-491s21c1
Sequence:CCGGGACTGCGGGCAGGCTATTTAACTCGAGTTAAATAGCCTGCCCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-188s21c1
Sequence:CCGGTATGCAGCAGGTGCACCAATGCTCGAGCATTGGTGCACCTGCTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-327s21c1
Sequence:CCGGTCAATGGATGCAGGAACTAAGCTCGAGCTTAGTTCCTGCATCCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-410s21c1
Sequence:CCGGCCTCATCCCAACAATGACCAACTCGAGTTGGTCATTGTTGGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-404s1c1
Sequence:CCGGCATGCACCTCATCCCAACAATCTCGAGATTGTTGGGATGAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-437s1c1
Sequence:CCGGGAAGGAGTCTCTGTCATCCATCTCGAGATGGATGACAGAGACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025591.2-113s1c1
Sequence:CCGGGAGAGAGAACATCCGGAAGATCTCGAGATCTTCCGGATGTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025591.2-1227s1c1
Sequence:CCGGGCTAAGAATAAGCAGTAACTACTCGAGTAGTTACTGCTTATTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-624s1c1
Sequence:CCGGCGGATCTTAGAAGGTGAAGTACTCGAGTACTTCACCTTCTAAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-410s1c1
Sequence:CCGGCCTCATCCCAACAATGACCAACTCGAGTTGGTCATTGTTGGGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-333s1c1
Sequence:CCGGGATGCAGGAACTAAGGAGCTTCTCGAGAAGCTCCTTAGTTCCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-296s1c1
Sequence:CCGGCACCATGCATTGCAATGACAACTCGAGTTGTCATTGCAATGCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025591
VALIDATED
FAM136A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 136, member A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-298s21c1
Sequence:CCGGCCATGCATTGCAATGACAAAGCTCGAGCTTTGTCATTGCAATGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-491s21c1
Sequence:CCGGGACTGCGGGCAGGCTATTTAACTCGAGTTAAATAGCCTGCCCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-188s21c1
Sequence:CCGGTATGCAGCAGGTGCACCAATGCTCGAGCATTGGTGCACCTGCTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-327s21c1
Sequence:CCGGTCAATGGATGCAGGAACTAAGCTCGAGCTTAGTTCCTGCATCCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-410s21c1
Sequence:CCGGCCTCATCCCAACAATGACCAACTCGAGTTGGTCATTGTTGGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-404s1c1
Sequence:CCGGCATGCACCTCATCCCAACAATCTCGAGATTGTTGGGATGAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-437s1c1
Sequence:CCGGGAAGGAGTCTCTGTCATCCATCTCGAGATGGATGACAGAGACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025591.2-113s1c1
Sequence:CCGGGAGAGAGAACATCCGGAAGATCTCGAGATCTTCCGGATGTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025591.2-1227s1c1
Sequence:CCGGGCTAAGAATAAGCAGTAACTACTCGAGTAGTTACTGCTTATTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-624s1c1
Sequence:CCGGCGGATCTTAGAAGGTGAAGTACTCGAGTACTTCACCTTCTAAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-410s1c1
Sequence:CCGGCCTCATCCCAACAATGACCAACTCGAGTTGGTCATTGTTGGGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-333s1c1
Sequence:CCGGGATGCAGGAACTAAGGAGCTTCTCGAGAAGCTCCTTAGTTCCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-296s1c1
Sequence:CCGGCACCATGCATTGCAATGACAACTCGAGTTGTCATTGCAATGCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025591
VALIDATED
FAM136A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 136, member A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-298s21c1
Sequence:CCGGCCATGCATTGCAATGACAAAGCTCGAGCTTTGTCATTGCAATGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-491s21c1
Sequence:CCGGGACTGCGGGCAGGCTATTTAACTCGAGTTAAATAGCCTGCCCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-188s21c1
Sequence:CCGGTATGCAGCAGGTGCACCAATGCTCGAGCATTGGTGCACCTGCTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-327s21c1
Sequence:CCGGTCAATGGATGCAGGAACTAAGCTCGAGCTTAGTTCCTGCATCCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025591.2-410s21c1
Sequence:CCGGCCTCATCCCAACAATGACCAACTCGAGTTGGTCATTGTTGGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-404s1c1
Sequence:CCGGCATGCACCTCATCCCAACAATCTCGAGATTGTTGGGATGAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-437s1c1
Sequence:CCGGGAAGGAGTCTCTGTCATCCATCTCGAGATGGATGACAGAGACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025591.2-113s1c1
Sequence:CCGGGAGAGAGAACATCCGGAAGATCTCGAGATCTTCCGGATGTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025591.2-1227s1c1
Sequence:CCGGGCTAAGAATAAGCAGTAACTACTCGAGTAGTTACTGCTTATTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-624s1c1
Sequence:CCGGCGGATCTTAGAAGGTGAAGTACTCGAGTACTTCACCTTCTAAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025591.2-410s1c1
Sequence:CCGGCCTCATCCCAACAATGACCAACTCGAGTTGGTCATTGTTGGGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-333s1c1
Sequence:CCGGGATGCAGGAACTAAGGAGCTTCTCGAGAAGCTCCTTAGTTCCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025591.2-296s1c1
Sequence:CCGGCACCATGCATTGCAATGACAACTCGAGTTGTCATTGCAATGCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks