EMAIL THIS PAGE TO A FRIEND

FAM13A

family with sequence similarity 13, member A

113 Gene Product Result for
Synonyms: ARHGAP48 FAM13A1
UniProtKB ID: O94988, B4DLC1, Q24JP0, Q5PR21, Q8NBA3
Gene ID:
Mouse(58909) family with sequence similarity 13, member A
Rat(362378) family with sequence similarity 13, member A
Zebrafish(559330) family with sequence similarity 13, member A
cow(282605) family with sequence similarity 13, member A
domestic cat(101092604) family with sequence similarity 13, member A
dog(487854) family with sequence similarity 13, member A
chicken(422515) family with sequence similarity 13, member A
sheep(101118358) family with sequence similarity 13, member A
domestic guinea pig(100717733) family with sequence similarity 13, member A
naked mole-rat(101697605) family with sequence similarity 13, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001015045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001015045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001015045 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076381 MISSION® esiRNA esiRNA human FAM13A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015045 Rosetta Predictions human pricing
NM_014883 Rosetta Predictions human pricing
XM_001060651 Rosetta Predictions rat pricing
XM_342702 Rosetta Predictions rat pricing
NM_153574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241981 predicted 1311
2 SASI_Hs01_00241982 predicted 719
3 SASI_Hs02_00306637 predicted 1640
4 SASI_Hs01_00241983 predicted 1863
5 SASI_Hs01_00241984 predicted 1273
6 SASI_Hs01_00241985 predicted 1688
7 SASI_Hs01_00241986 predicted 1391
8 SASI_Hs01_00241987 predicted 1175
9 SASI_Hs01_00241988 predicted 1942
10 SASI_Hs01_00241989 predicted 567
11 SASI_Hs01_00241990 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153165 predicted 2248
2 SASI_Hs01_00153166 predicted 1659
3 SASI_Hs02_00346500 predicted 2575
4 SASI_Hs01_00153167 predicted 2808
5 SASI_Hs01_00153168 predicted 2211
6 SASI_Hs01_00153169 predicted 2632
7 SASI_Hs01_00153170 predicted 2327
8 SASI_Hs01_00153171 predicted 2119
9 SASI_Hs01_00153172 predicted 2882
10 SASI_Hs01_00153173 predicted 1508
11 SASI_Hs01_00153174 predicted 2603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297230 predicted 415
2 SASI_Rn02_00297231 predicted 2048
3 SASI_Rn02_00297232 predicted 1754
4 SASI_Rn02_00297233 predicted 510
5 SASI_Rn02_00297234 predicted 557
6 SASI_Rn02_00297235 predicted 1802
7 SASI_Rn02_00297236 predicted 1879
8 SASI_Rn02_00297237 predicted 1161
9 SASI_Rn02_00297238 predicted 1013
10 SASI_Rn02_00297239 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394691 predicted 418
2 SASI_Rn02_00394692 predicted 260
3 SASI_Rn02_00394693 predicted 440
4 SASI_Rn02_00394694 predicted 314
5 SASI_Rn02_00394695 predicted 219
6 SASI_Rn02_00394696 predicted 438
7 SASI_Rn02_00394697 predicted 232
8 SASI_Rn02_00394698 predicted 273
9 SASI_Rn02_00394699 predicted 409
10 SASI_Rn02_00394700 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198458 predicted 524
2 SASI_Mm01_00198459 predicted 565
3 SASI_Mm01_00198460 predicted 699
4 SASI_Mm01_00198461 predicted 1439
5 SASI_Mm01_00198462 predicted 1266
6 SASI_Mm01_00198463 predicted 1811
7 SASI_Mm01_00198464 predicted 808
8 SASI_Mm02_00343381 predicted 1024
9 SASI_Mm01_00198465 predicted 200
10 SASI_Mm01_00198467 predicted 422
11 SASI_Mm01_00198466 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153574
FAM13A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 13, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.1-773s1c1
Sequence:CCGGCCCAGTCTATCTGACACCAAACTCGAGTTTGGTGTCAGATAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153574.1-3880s1c1
Sequence:CCGGCCAGGAGTTATACTATGAATACTCGAGTATTCATAGTATAACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.2-1921s1c1
Sequence:CCGGGATGATGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.2-1643s1c1
Sequence:CCGGCAAAGACTGAGCGTCAGATAACTCGAGTTATCTGACGCTCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1643s21c1
Sequence:CCGGCAAAGACTGAGCGTCAGATAACTCGAGTTATCTGACGCTCAGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-529s21c1
Sequence:CCGGGAAAGATTCCAGGACGATATTCTCGAGAATATCGTCCTGGAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1534s21c1
Sequence:CCGGAGCCGTCCTGAGGACATTAAGCTCGAGCTTAATGTCCTCAGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1921s21c1
Sequence:CCGGGATGATGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153574.2-3810s21c1
Sequence:CCGGACGATACATAATCCTACAAATCTCGAGATTTGTAGGATTATGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153574
FAM13A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 13, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.1-773s1c1
Sequence:CCGGCCCAGTCTATCTGACACCAAACTCGAGTTTGGTGTCAGATAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153574.1-3880s1c1
Sequence:CCGGCCAGGAGTTATACTATGAATACTCGAGTATTCATAGTATAACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.2-1921s1c1
Sequence:CCGGGATGATGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.2-1643s1c1
Sequence:CCGGCAAAGACTGAGCGTCAGATAACTCGAGTTATCTGACGCTCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1643s21c1
Sequence:CCGGCAAAGACTGAGCGTCAGATAACTCGAGTTATCTGACGCTCAGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-529s21c1
Sequence:CCGGGAAAGATTCCAGGACGATATTCTCGAGAATATCGTCCTGGAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1534s21c1
Sequence:CCGGAGCCGTCCTGAGGACATTAAGCTCGAGCTTAATGTCCTCAGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1921s21c1
Sequence:CCGGGATGATGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153574.2-3810s21c1
Sequence:CCGGACGATACATAATCCTACAAATCTCGAGATTTGTAGGATTATGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153574
FAM13A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 13, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.1-773s1c1
Sequence:CCGGCCCAGTCTATCTGACACCAAACTCGAGTTTGGTGTCAGATAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153574.1-3880s1c1
Sequence:CCGGCCAGGAGTTATACTATGAATACTCGAGTATTCATAGTATAACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.2-1921s1c1
Sequence:CCGGGATGATGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153574.2-1643s1c1
Sequence:CCGGCAAAGACTGAGCGTCAGATAACTCGAGTTATCTGACGCTCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1643s21c1
Sequence:CCGGCAAAGACTGAGCGTCAGATAACTCGAGTTATCTGACGCTCAGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-529s21c1
Sequence:CCGGGAAAGATTCCAGGACGATATTCTCGAGAATATCGTCCTGGAATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1534s21c1
Sequence:CCGGAGCCGTCCTGAGGACATTAAGCTCGAGCTTAATGTCCTCAGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153574.2-1921s21c1
Sequence:CCGGGATGATGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153574.2-3810s21c1
Sequence:CCGGACGATACATAATCCTACAAATCTCGAGATTTGTAGGATTATGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015045
VALIDATED
FAM13A MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 13, member A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-3965s1c1
Sequence:CCGGGCCTTTAAGTTTGCTCTTAATCTCGAGATTAAGAGCAAACTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-660s1c1
Sequence:CCGGGCAAGCCTAAACGTCAGAAATCTCGAGATTTCTGACGTTTAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015045.1-1753s1c1
Sequence:CCGGGCAGGTGATGAAGCCACTATACTCGAGTATAGTGGCTTCATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-1183s1c1
Sequence:CCGGCCCACCAAACTCCCATTCTTTCTCGAGAAAGAATGGGAGTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-305s1c1
Sequence:CCGGCCTTTCTATTTGAGTGCTCATCTCGAGATGAGCACTCAAATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-1812s21c1
Sequence:CCGGCTAACACCATACCCATCATTGCTCGAGCAATGATGGGTATGGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015045.1-412s21c1
Sequence:CCGGTAATAACTCTGGAGGTCAAAGCTCGAGCTTTGACCTCCAGAGTTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-2018s21c1
Sequence:CCGGGATGACGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-1859s21c1
Sequence:CCGGCCTTTGCTGCAGCCAATTATCCTCGAGGATAATTGGCTGCAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-2164s21c1
Sequence:CCGGTCGAAAGAAACTTCGGGATTTCTCGAGAAATCCCGAAGTTTCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015045
VALIDATED
FAM13A MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 13, member A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-3965s1c1
Sequence:CCGGGCCTTTAAGTTTGCTCTTAATCTCGAGATTAAGAGCAAACTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-660s1c1
Sequence:CCGGGCAAGCCTAAACGTCAGAAATCTCGAGATTTCTGACGTTTAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015045.1-1753s1c1
Sequence:CCGGGCAGGTGATGAAGCCACTATACTCGAGTATAGTGGCTTCATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-1183s1c1
Sequence:CCGGCCCACCAAACTCCCATTCTTTCTCGAGAAAGAATGGGAGTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-305s1c1
Sequence:CCGGCCTTTCTATTTGAGTGCTCATCTCGAGATGAGCACTCAAATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-1812s21c1
Sequence:CCGGCTAACACCATACCCATCATTGCTCGAGCAATGATGGGTATGGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015045.1-412s21c1
Sequence:CCGGTAATAACTCTGGAGGTCAAAGCTCGAGCTTTGACCTCCAGAGTTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-2018s21c1
Sequence:CCGGGATGACGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-1859s21c1
Sequence:CCGGCCTTTGCTGCAGCCAATTATCCTCGAGGATAATTGGCTGCAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-2164s21c1
Sequence:CCGGTCGAAAGAAACTTCGGGATTTCTCGAGAAATCCCGAAGTTTCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015045
VALIDATED
FAM13A MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 13, member A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-3965s1c1
Sequence:CCGGGCCTTTAAGTTTGCTCTTAATCTCGAGATTAAGAGCAAACTTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-660s1c1
Sequence:CCGGGCAAGCCTAAACGTCAGAAATCTCGAGATTTCTGACGTTTAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015045.1-1753s1c1
Sequence:CCGGGCAGGTGATGAAGCCACTATACTCGAGTATAGTGGCTTCATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-1183s1c1
Sequence:CCGGCCCACCAAACTCCCATTCTTTCTCGAGAAAGAATGGGAGTTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015045.1-305s1c1
Sequence:CCGGCCTTTCTATTTGAGTGCTCATCTCGAGATGAGCACTCAAATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-1812s21c1
Sequence:CCGGCTAACACCATACCCATCATTGCTCGAGCAATGATGGGTATGGTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015045.1-412s21c1
Sequence:CCGGTAATAACTCTGGAGGTCAAAGCTCGAGCTTTGACCTCCAGAGTTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-2018s21c1
Sequence:CCGGGATGACGCTGATGGATTTATTCTCGAGAATAAATCCATCAGCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-1859s21c1
Sequence:CCGGCCTTTGCTGCAGCCAATTATCCTCGAGGATAATTGGCTGCAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015045.1-2164s21c1
Sequence:CCGGTCGAAAGAAACTTCGGGATTTCTCGAGAAATCCCGAAGTTTCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks