EMAIL THIS PAGE TO A FRIEND

FAM13B

family with sequence similarity 13, member B

219 Gene Product Result for
Synonyms: ARHGAP49 C5orf5 FAM13B1 KHCHP N61
UniProtKB ID: Q9NYF5, D3DQB5, G3V0H9, Q3ZCR0, Q6PGQ2, Q9P0I7
Gene ID:
Mouse(225358) family with sequence similarity 13, member B
Rat(291694) family with sequence similarity 13, member B
Zebrafish(568603) family with sequence similarity 13, member B
cow(540987) family with sequence similarity 13, member B
domestic cat(101084339) family with sequence similarity 13, member B
dog(474690) family with sequence similarity 13, member B
naked mole-rat(101707665) family with sequence similarity 13, member B
domestic guinea pig(100728298) family with sequence similarity 13, member B
sheep(101107784) family with sequence similarity 13, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016603 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121271 MISSION® esiRNA esiRNA human C5orf5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101800 Rosetta Predictions human pricing
NM_001101801 Rosetta Predictions human pricing
NM_016603 Rosetta Predictions human pricing
NM_001106158 Rosetta Predictions rat pricing
NM_146084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322953 predicted 1186
2 SASI_Hs02_00322954 predicted 1474
3 SASI_Hs02_00322955 predicted 2870
4 SASI_Hs02_00322956 predicted 2192
5 SASI_Hs02_00322957 predicted 1581
6 SASI_Hs02_00322958 predicted 1369
7 SASI_Hs02_00322959 predicted 2960
8 SASI_Hs02_00322960 predicted 2834
9 SASI_Hs02_00322961 predicted 1610
10 SASI_Hs02_00322962 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322963 predicted 1001
2 SASI_Hs02_00322964 predicted 1288
3 SASI_Hs02_00322965 predicted 2747
4 SASI_Hs02_00322966 predicted 2061
5 SASI_Hs02_00322967 predicted 1389
6 SASI_Hs02_00322968 predicted 1177
7 SASI_Hs02_00322969 predicted 2834
8 SASI_Hs02_00322970 predicted 2712
9 SASI_Hs02_00322971 predicted 1422
10 SASI_Hs02_00322972 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349733 predicted 1187
2 SASI_Hs02_00349734 predicted 1478
3 SASI_Hs02_00349735 predicted 2949
4 SASI_Hs02_00349736 predicted 2192
5 SASI_Hs02_00349737 predicted 1575
6 SASI_Hs01_00057054 predicted 1372
7 SASI_Hs01_00057057 predicted 3041
8 SASI_Hs02_00349738 predicted 2919
9 SASI_Hs02_00349739 predicted 1618
10 SASI_Hs01_00057060 predicted 1322
11 SASI_Hs01_00057053 predicted 719
12 SASI_Hs01_00057055 predicted 774
13 SASI_Hs01_00057056 predicted 2552
14 SASI_Hs01_00057058 predicted 2661
15 SASI_Hs01_00057059 predicted 561
16 SASI_Hs01_00057061 predicted 2666
17 SASI_Hs01_00057062 predicted 2153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216198 predicted 2594
2 SASI_Rn02_00216199 predicted 2867
3 SASI_Rn02_00216200 predicted 2977
4 SASI_Rn02_00216201 predicted 765
5 SASI_Rn02_00216202 predicted 649
6 SASI_Rn02_00216203 predicted 1909
7 SASI_Rn02_00216204 predicted 717
8 SASI_Rn02_00216205 predicted 2002
9 SASI_Rn02_00216206 predicted 1984
10 SASI_Rn02_00216207 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100618 predicted 1939
2 SASI_Mm01_00100619 predicted 2601
3 SASI_Mm01_00100621 predicted 770
4 SASI_Mm01_00100622 predicted 2125
5 SASI_Mm01_00100623 predicted 2000
6 SASI_Mm01_00100624 predicted 1994
7 SASI_Mm01_00100625 predicted 660
8 SASI_Mm02_00341719 predicted 1092
9 SASI_Mm01_00100626 predicted 1380
10 SASI_Mm01_00100627 predicted 2499
11 SASI_Mm01_00100620 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146084
VALIDATED
FAM13B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 13, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-624s21c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146084.1-2108s21c1
Sequence:CCGGAGCCAATCCGAAGGTATTAAACTCGAGTTTAATACCTTCGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146084.1-1604s21c1
Sequence:CCGGTAGTAGCAAGATACGTGATTTCTCGAGAAATCACGTATCTTGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-1920s21c1
Sequence:CCGGGCGTTGGATTTCTCGTCAAAGCTCGAGCTTTGACGAGAAATCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-1860s21c1
Sequence:CCGGGTATTATCTCATCGTAGTTTACTCGAGTAAACTACGATGAGATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-2339s1c1
Sequence:CCGGGCTGATTACCAAACGGTTGAACTCGAGTTCAACCGTTTGGTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-1855s1c1
Sequence:CCGGCTCCAGTATTATCTCATCGTACTCGAGTACGATGAGATAATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146084.1-3191s1c1
Sequence:CCGGCAAGGAAAGCTGTTCCACATTCTCGAGAATGTGGAACAGCTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-2303s1c1
Sequence:CCGGGAAAGAGAAGACGCCATCGAACTCGAGTTCGATGGCGTCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146084
VALIDATED
FAM13B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 13, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-624s21c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146084.1-2108s21c1
Sequence:CCGGAGCCAATCCGAAGGTATTAAACTCGAGTTTAATACCTTCGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146084.1-1604s21c1
Sequence:CCGGTAGTAGCAAGATACGTGATTTCTCGAGAAATCACGTATCTTGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-1920s21c1
Sequence:CCGGGCGTTGGATTTCTCGTCAAAGCTCGAGCTTTGACGAGAAATCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-1860s21c1
Sequence:CCGGGTATTATCTCATCGTAGTTTACTCGAGTAAACTACGATGAGATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-2339s1c1
Sequence:CCGGGCTGATTACCAAACGGTTGAACTCGAGTTCAACCGTTTGGTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-1855s1c1
Sequence:CCGGCTCCAGTATTATCTCATCGTACTCGAGTACGATGAGATAATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146084.1-3191s1c1
Sequence:CCGGCAAGGAAAGCTGTTCCACATTCTCGAGAATGTGGAACAGCTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-2303s1c1
Sequence:CCGGGAAAGAGAAGACGCCATCGAACTCGAGTTCGATGGCGTCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146084
VALIDATED
FAM13B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 13, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-624s21c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146084.1-2108s21c1
Sequence:CCGGAGCCAATCCGAAGGTATTAAACTCGAGTTTAATACCTTCGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146084.1-1604s21c1
Sequence:CCGGTAGTAGCAAGATACGTGATTTCTCGAGAAATCACGTATCTTGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-1920s21c1
Sequence:CCGGGCGTTGGATTTCTCGTCAAAGCTCGAGCTTTGACGAGAAATCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146084.1-1860s21c1
Sequence:CCGGGTATTATCTCATCGTAGTTTACTCGAGTAAACTACGATGAGATAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-2339s1c1
Sequence:CCGGGCTGATTACCAAACGGTTGAACTCGAGTTCAACCGTTTGGTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-1855s1c1
Sequence:CCGGCTCCAGTATTATCTCATCGTACTCGAGTACGATGAGATAATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146084.1-3191s1c1
Sequence:CCGGCAAGGAAAGCTGTTCCACATTCTCGAGAATGTGGAACAGCTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146084.1-2303s1c1
Sequence:CCGGGAAAGAGAAGACGCCATCGAACTCGAGTTCGATGGCGTCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016603
VALIDATED
FAM13B MISSION shRNA Bacterial Glycerol Stock
family with sequence similarity 13, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-2337s21c1
Sequence:GTACCGGTGCCAATCCAAAGGTATTAAACTCGAGTTTAATACCTTTGGATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016603.2-3932s21c1
Sequence:CCGGGGTGACCTCGCTTAGTATATTCTCGAGAATATACTAAGCGAGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016603.2-661s21c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-1707s21c1
Sequence:CCGGTACCCAGTCTGTAGGTATATTCTCGAGAATATACCTACAGACTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-1372s21c1
Sequence:CCGGACGGCAACAAGCACCCATATACTCGAGTATATGGGTGCTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016603.1-2965s1c1
Sequence:CCGGGCAGCTTCTATGCCTGAATTACTCGAGTAATTCAGGCATAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-728s1c1
Sequence:CCGGCCTCAGCTATTAGCCTTCTTACTCGAGTAAGAAGGCTAATAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-1777s1c1
Sequence:CCGGGCCAACACTGAATCAGAAGTACTCGAGTACTTCTGATTCAGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-2464s1c1
Sequence:CCGGCCATCTAAAGAAGCAACCCTTCTCGAGAAGGGTTGCTTCTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-580s1c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016603
VALIDATED
FAM13B MISSION shRNA shRNA Plasmid DNA
family with sequence similarity 13, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-2337s21c1
Sequence:GTACCGGTGCCAATCCAAAGGTATTAAACTCGAGTTTAATACCTTTGGATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016603.2-3932s21c1
Sequence:CCGGGGTGACCTCGCTTAGTATATTCTCGAGAATATACTAAGCGAGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016603.2-661s21c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-1707s21c1
Sequence:CCGGTACCCAGTCTGTAGGTATATTCTCGAGAATATACCTACAGACTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-1372s21c1
Sequence:CCGGACGGCAACAAGCACCCATATACTCGAGTATATGGGTGCTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016603.1-2965s1c1
Sequence:CCGGGCAGCTTCTATGCCTGAATTACTCGAGTAATTCAGGCATAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-728s1c1
Sequence:CCGGCCTCAGCTATTAGCCTTCTTACTCGAGTAAGAAGGCTAATAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-1777s1c1
Sequence:CCGGGCCAACACTGAATCAGAAGTACTCGAGTACTTCTGATTCAGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-2464s1c1
Sequence:CCGGCCATCTAAAGAAGCAACCCTTCTCGAGAAGGGTTGCTTCTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-580s1c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016603
VALIDATED
FAM13B MISSION shRNA Lentiviral Transduction Particles
family with sequence similarity 13, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-2337s21c1
Sequence:GTACCGGTGCCAATCCAAAGGTATTAAACTCGAGTTTAATACCTTTGGATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016603.2-3932s21c1
Sequence:CCGGGGTGACCTCGCTTAGTATATTCTCGAGAATATACTAAGCGAGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016603.2-661s21c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-1707s21c1
Sequence:CCGGTACCCAGTCTGTAGGTATATTCTCGAGAATATACCTACAGACTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016603.2-1372s21c1
Sequence:CCGGACGGCAACAAGCACCCATATACTCGAGTATATGGGTGCTTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016603.1-2965s1c1
Sequence:CCGGGCAGCTTCTATGCCTGAATTACTCGAGTAATTCAGGCATAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-728s1c1
Sequence:CCGGCCTCAGCTATTAGCCTTCTTACTCGAGTAAGAAGGCTAATAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-1777s1c1
Sequence:CCGGGCCAACACTGAATCAGAAGTACTCGAGTACTTCTGATTCAGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-2464s1c1
Sequence:CCGGCCATCTAAAGAAGCAACCCTTCTCGAGAAGGGTTGCTTCTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016603.1-580s1c1
Sequence:CCGGCGCCACGTTGTGGACTATATTCTCGAGAATATAGTCCACAACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks